Skip to main content

Table 2 Sequence of primers used for quantitative real-time PCR

From: Toxoplasmosis and abortion: pro- and anti-inflammatory cytokines gene expression of the host immune cells

Gene Forward primer (5′-3 ′) Reverse primer (5′-3′)
β-actin GTGGGGCGCCCCAGGCACCAG TCCTTAATGTCACGCACGATTTC
TNF-α ACCATGAGCACTGAAAGCAT AGATGAGGTACAGGCCCTCT
IFN-γ TTGGGTTCTCTTGGCTGTTA AAATATTGCAGGCAGGACAA
TGF-β CCCAGCATCTGCAAAGCTC GTCAATGTACAGCTGCCGCA
IL-10 GGTTGCCAAGCCTTGTCTGA AGGGAGTTCACATGCGCCT