Skip to main content

Table 1 Primer sequences for TAAA repeated sequence in the p53 gene

From: Association study of TAAAA polymorphism in the first intron of p53 gene with risk of colorectal cancer in Iranian population

Gene name Amplified sequence name Amplified region Primer Sequence (5′-3′)
p53 (TAAAA)n Intron F AATCCGGGAGGAGGTTGCAG TAAG
R ACAGCTCCTTTAATGGCAGG CTCTTT