Skip to main content

Table 2 Primers sequences

From: DNA integrity index as a potential molecular biomarker in colorectal cancer

ALU 115 Forward primer (F115) 5′ CCTGAGGTCAGGAGTTCGAG′3
ALU 115 Reverse primer (R115) 5′ CCCGAGTAGCTGGGATTACA′3
ALU 247 Forward primer (F247) 5′ GTGGCTCACGCCTGTAATC′3
ALU 247 Reverse primer (R247) 5′ CAGGCTGGAGTGCAGTGG′3.
  1. ALU the Arthrobacter luteus, F forward, R reverse