Skip to main content

Table 1 Target MiRNA and endogenous control sequences to be studied and amplified by RT-qPCR

From: Expression of miR-146a and miR-155 in Egyptian patients with Behçet’s disease: clinical significance and relationship with disease activity

MiRNA MiRbase No. Mature sequence
U6snRNA NR_004394 GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT
MiR-146a MIMAT0000449 UGAGAACUGAAUUCCAUGGGUU
MiR-155 MIMAT0000646 UUAAUGCUAAUCGUGAUAGGGGU