Skip to main content

Table 1 List of primers used in qRT-PCR

From: In vitro characterization of human bone marrow mesenchymal stem cell-derived motor neurons induced by epigenetic modifiers

Target gene Primer sequence
GAPDH F: CTCATTTCCTGGTATGACAAC
R: CTTCCTCTTGTGCTCTTGCT
CHAT F: GCA GGAGAAGACAGCCAACT
R: TGCAAACCTCAGCTGGTCAT
MNX-1 F: AGCACCAGTTCAAGCTCAACA
R: ACCAAATCTTCACCTGGGTCTC
ISLET-1 F: ATATCAGGTTGTACGGGATCAAATG
R: CACGCATCACGAAGTCGTTC
P300 F: GTTCTCCCTTACAGCAGCAACA
R: GCAGAGGATTCATGTTCTGCAAG
EZH-2 F: CCGGGCTAGGTTAATTGGGACCAAA
R: CTCGAGTTTGGTCCCAATTAACCT