Skip to main content

Table 1 The primers used in pyrosequencing

From: SCGB3A1 gene DNA methylation status is associated with breast cancer in Egyptian female patients

Gene symbol Entrez Gene ID Qiagen product code Pyrosequencing primers* Chromosomal location Number of CpG sites PCR product size
ATM 4863/472 Hs_NPAT/ATM_01_PM
(PM00153622)
CGCGGACGCGGGAWGGAGGGTTATTGGACCCGGC Chromosome 11, BP 1080931X-1080932XX 4 203 bp
SCGB3A1/HIN-1 92304 Hs_SCGB3A1_01_PM
(PM0022687)
GGGGCGTTTTTCTGTCTTCGAAACTAGCCTCGACGC Chromosome 5, BP 1800190XX-1800190XX 4 90 bp
  1. *Primer sequences were adopted from PyroMark Assay Database