Skip to main content

Table 1 Oligonucleotides primers used in the study

From: Prevalence of enterotoxin genes (SEA to SEE) and antibacterial resistant pattern of Staphylococcus aureus isolated from clinical specimens in Assiut city of Egypt

Gene Primer Oligonucleotide sequence
5–3
Size of amplified products (bp) Annealing temp. oC References
SEA F GGTTATCAATGTGCGGGTG 102 52 Marsha and Betley [21]
R CGGCACTTTTTTCTCTTCGG
SEB F GTATGGTGGTGTAACTGAGC 478 52 Jones and Khan [22]
R CCAAATAGTGACGAGTTAGG
SEC F AGATGAAGTAGTTGATGTGTATGG 451 50 Bohach and Schlievert [23]
R CACACTTTTAGAATCAACCG
SED F CCAATAATAGGAGAAAATAAAAG 278 50 Bayles and Iandolo [24]
R ATTGGTATTTTTTTTCGTTC
SEE F AGGTTTTTTCACAGGTCATCC 209 50 Couch et al. [25]
R CTTTTTTTTCTTCGGTCAATC
16 s rRNA F AGAGTTTGATCMTGGCTCAG 1500 55 Turner et al. [27]
R AACTGGAGGAAGGTGGGAT