Skip to main content

Table 1 List of designed, optimized and synthesized primers specific for each gene

From: Momordica charantia nanoparticles promote mitochondria biogenesis in the pancreas of diabetic-induced rats: gene expression study

Gene name Forward primer Reverse primer
IL-1B GCAATGGTCGGGACATAGTT AGACCTGACTTGGCAGAGGA
TNF Alpha ACCACGCTCTTCTGTCTACTG CTTGGTGGTTTGCTACGAC
PGC-1 Alpha TTCAGGAGCTGGATGGCTTG GGGCAGCACACTCTATGTCA
Insulin rats GTCCTCTGGGAGCCCAAG ACAGAGCCTCCACCAGG
Glucokinase GTGTACAAGCTGCACCCGA CAGCATGCAAGCCTTCTTG
AMPK ATCCGCAGAGAGATCCAGAA CGTCGACTCTCCTTTTCGTC
Gsk3b GGGACAGTGGTGTGGATCAG GCCGAAAGACCTTCGTCCAA
Glut2 TAGTCAGATTGCTGGCCTCAGCTT TTGCCCTGACTTCCTCTTCCAAC
PI3K AACACAGAAGACCAATACTC TTCGCCATCTACCACTAC
AKT TCACCTCTGAGACCGACACC ACTGGCTGAGTAGGAGAACTGG
PTEN CCCACCACAGCTAGAAACTTATC CGTCCTTTCCCAGCTTTACA