Skip to main content

Table 1 PCR primers used for the PCR-sequencing of exon 9 of ATRX gene

From: New heritable ATRX mutation identified by whole exome sequencing and review

Primer name Primer sequence 5′ > 3′
ATRX-F GATGAGTCACAGTTCTTCTTCAG
ATRX-R TCTTTTTTTGGTGGTTCTGGC