Skip to main content

Table 1 Primers and annealing temperature of the genes included in the study

From: A study of nasal epithelial cell gene expression in a sample of mild to severe asthmatic children and healthy controls

Gene Forward primer Reverse primer An.Tm References
TMEM178 5′-ACTTATGCCGCCAGTATCTCG-3′ 5′-AGGCGCAAAAGATGGACCAG-3′ 55 [13]
FKBP5 5′-GGATATACGCCAACATGTTCAA-3′ 5′-CCATTGCTTTATTGGCCTCT-3′ 51 [14]
CLCA1 5′- ATGGCTATGAAGGCATTGTCG -3′ 5′- TGGCACATTGGGGTCGATTG -3′ 54 [15]
SERPINB2 5′-GCTGGAGATGTTAGCATGTTCTTG-3′ 5′-GGCTTGGTGGAACACTTCAGAAAG-3′ 54 [16]
Periostin 5′-GACTCAAGATGATTCCCTTT -3′ 5′-GGTGCAAAGTAAGTGAAGGA-3′ 47 [17]
GAPDH 5'-TGCACCACCAACTGCTTAGC-3' 5'-GGCATGGACTGTGGTCATGAG-3' 57 [18]
  1. TMEM178: transmembrane protein 178, CLCA1: chloride pathway, calcium activated family member 1, SERPINB2: serpin peptidase inhibitor, clade B, member 2, GAPDH; glyceraldehyde 3-phosphate dehydrogenase