Skip to main content

Table 1 The PCR primers for real-time PCR (Integrated DNA Technologies, IDT)

From: Generation of muscle progenitors from human-induced pluripotent stem cells

Gene product Primer forward Primer reverse Product size (bp)
Myf5 GAGAGAGCAGGTGGAGAACT TGGACCAGACAGGACTGTTA 116
Desmin TACACCTGCGAGATTGACGC CTGGCAAATCGGTCCTCCAA 83
Dystrophin TCAGGAGAAAGATGCTGTTTTGC GGTTCTCAATATGCTGCTTCCC 182
B-Actin CACAGAGCCTCGCCTTTGC GAGCGCGGCGATATCATCA 80
PAX7 TGGCCGGCTATCAGTACG CAGAGTGCTCCCCGAGCTT 105
MYOD AAGGCGCCTACTACAACGAG AGGCAGTCTAGGCTCGACAC 76
MYOGENIN TCAACCAGGAGGAGCGTGA TCTGTAGGGTCAGCCGTGAG 166
MYH-2 CTTTCAAGAGGGACACTGGTCA TAGCCTGGGAGTGAGACAGTT 77
GAPDH TTAGGAAAGCCTGCCGGTGA GGCGCCCAATACGACCAAA 157
Meox1 CAGGACGAACTCCTCGTCAG GGCTGAGAAGTCAGGGTACG 74
Meox2 TGGTTCCAAAACAGGCGGAT ACCAGTTCCTTTTCCCGAGC 80
PAX3 CGGCTAGCTGACATTGGTGA TCCATGTCGTTACTCAGGCG 96
Hand1 ATATAAGCCAGATCCGCAGGG TTCTTACCGGTTTCTGCCGC 90
Hand2 ATTCCGGGTTAGCTTCGGTG GGAGGCAGAATCCTCTCGTG 117
Mesp1 CGAGTCCTGGATGCTCTCTG ATGAGTCTGGGGACGAGACG 98
DKK1 CGGGCGGGAATAAGTACCAG GGGACTAGCGCAGTACTCATC 95
Cdh4 CAAGGATTCGATGAACGGCA ACACAGCTGCTGAACTTGACT 87
Lhx2 AACTTCTGTGCCTGGCAACC AAGAAATTGTGGGGTGAGGGG 107
Myl7 (Mlic-2a) GGAGTTCAAAGAAGCCTTCAGC TAGGTCTCCCTCAGGTCTGC 78
Nppa (ANP) AGCAGTGGATTGCTCCTTGA GACACGGCATTGTACATGGG 128
Pitx2 CTCCTGTTCGACCGCCC AGCCCTGACAGAGAAGTGTC 151
Podxl AACGAAATCTTGGCCTCGGT TTGCTGAGCCAGGGTTGTAG 81
Tbx1 CGAGGAGACACGATTCACCG TTGCTGGCAATCTTGAGCTG 72
Tcf15 TGGTCAGAGACAAGGCAGAAC TCTCCTCAGCTCAGAACGAC 157
Tnnt2 CATCCAGAAGACAGAGCGGAAAAG CCTCCTCTCAGCCAGAATCTT 79
Isl1 TTTCCCTGAATCTCCCCACTC ACTACACTGAGGCAAACTTCACA 76
NKX2.5 GTATCCGAGCCTGGTAGGGA GGACTCAGGGTCATGTTGGG 112
GATA4 TGGAAGCACCAGGAAGCATT CAGCCGGTTACAGACGAGAG 135
Mef2c GCAAAGCCTCGGTCTTCATAGA ACCAGCTGGCTTTGAAGAGAA 92
Tbx5 TCAGTCCCCCGGAACAACTC GGAACTCTTCACGAAGGGAGG 77
Mlc2v (Mylk3) AGCTTGCACAGATCTTGTCT CAAACTTAAACCTGGAGGCAGT 70
Myh6 AGATAGAGAGACTCCTGCGGC TCTGGGCATCGGTCATCTTG 87
Connexin 43 TCTGAGTGCCTGAACTTGCC GGGCACCACTCTTTTGCTTA 97