Table 1 Primers and PCR conditions used for the three studied SNPs
From: STAT3 gene polymorphisms and susceptibility to breast cancer in the Moroccan population
SNP | Primers | PCR conditions | PCR product (bp) | Reference | |
|---|---|---|---|---|---|
rs744166 | Forward | GCTGTAATGTCTTGAGGGAATCAAGC | 95 °C—5 min.; 35 cycles (94 °C—0.5 min., 58 °C—1 min. and 72 °C—1 min.) and 72 °C—5 min | 144 | [25] |
Reverse | TATTCAGATGGCGGTCACATGC | ||||
rs2293152 | Forward | TCCCCTGTGATTCAGATCCC | 95 °C—5 min.; 35 cycles (94 °C—0.5 min., 55 °C—1 min. and 72 °C—1 min.) and 72 °C—5 min | 214 | [26] |
Reverse | CATTCCCACATCTCTGCTCC | ||||
rs4796793 | Forward primer (F) | TCTGGTAGACACAGCTCAGTATGG | 95 °C—5 min.; 35 cycles (94 °C—1 min. (65 ºC for the first PCR and 66 °C for the second PCR)—1 min. and 72 °C—1 min.) and 72 °C—5 min | First PCR: 502 | [24] |
Common reverse primer (R) | CCATAGTCGCAGAGGTAGATTTTA | Â | |||
Specific forward primer C (F1) | TGTTTAGTGATTTACTGCTTACAAAGG | Â | |||
Specific forward primer G (F2) | TGTTTAGTGATTTACTGCTTACAAAGC | Second PCR: 316 | |||