Skip to main content
Egyptian Journal of Medical Human Genetics
Download PDF

The contribution of FTO rs9939609 and RETN rs1862513 polymorphisms in predisposing resettled indigenous (Orang Asli) Temiar to metabolic syndrome

Egyptian Journal of Medical Human Genetics volume 24, Article number: 44 (2023) Cite this article

Abstract

Purpose

Metabolic syndrome (MetS) is characterized by visceral obesity, elevated blood pressure and fasting blood glucose, increased triglycerides, and lower high-density lipoprotein cholesterol. MetS related with intricate gene-environment interactions. FTO and RETN variants were linked to the occurrence of MetS, but inconsistent results were reported. Therefore, this study was conducted to evaluate the potential role of FTO rs9939609 and RETN rs1862513 polymorphisms and their susceptibility risk to MetS among resettled indigenous or Orang Asli (OA) of Temiar subtribe under resettlement scheme by the Malaysia government.

Methods

A cross sectional study was performed involving 123 Temiar volunteers located in Gua Musang, Kelantan. MetS was identified using modified NCEP-ATP III. DNA extraction was done using peripheral blood. Polymerase Chain Reaction–Restriction Fragment Length Polymorphism (PCR–RFLP) was employed to genotype FTO rs9939609 and RETN rs1862513 polymorphisms. Susceptibility risk of the polymorphisms (FTO rs9939609 and RETN rs1862513) with MetS was determined by binary logistic regression analysis and odds ratios (ORs).

Results

FTO rs9939609 and RETN rs1862513 were associated with risk of MetS susceptibility among the Temiar subtribe with estimated OR 19.9 (P < 0.001) and 20.7 (P = 0.006) for heterozygous (T/A) and homozygous (A/A) genotype at FTO rs9939609 locus, respectively; OR 222.5 (P < 0.001) and 26.2 (P = 0.005) for heterozygous (C/G) and homozygous (G/G) genotype at RETN rs1862513 locus, respectively.

Conclusion

The genetic polymorphisms of FTO rs9939609 and RETN rs1862513 were associated with the risk of MetS among the Temiar subtribe. The findings contribute toward the fundamental prevention plan to decrease the probability of MetS development.

Introduction

Metabolic syndrome (MetS) is described as a cluster of metabolic chaos comprising elevated level of both fasting glucose and blood pressure, visceral obesity, higher triglycerides and lower high-density lipoprotein (HDL) cholesterol [1]. The increment in its prevalence is alarming. It has been reported that MetS may create an increment at five-times and two-times risk progressing into type 2 diabetes mellitus (T2DM) and cardiovascular diseases (CVD), respectively [2]. The prevalence of MetS is reported to be parallelly increasing with the epidemic of obesity. Rapid urbanization has resulted in behavioral alteration and exposing the world population to obesogenic environment. The occurrence of MetS is impacted by the progression of genetic predisposition and environmental factors. The pathogenesis of MetS is however, not completely recognized [3]. Apart from insulin resistance (IR) and visceral obesity [3, 4], MetS is also identified with strong genetic predisposition [5,6,7]. Approximately 24% of the MetS cases are associated with genetic factors [8].

Fat mass and obesity associated (FTO) that was acknowledged to be located on chromosome 16 (16q12.2) encodes 2-oxoglutarate-dependent nucleic acid demethylase. It is extensively secreted in various tissues, such as the hypothalamus and crucially govern the energy balance system [9, 10]. FTO was the first gene identified by genome-wide association studies (GWAS) to be linked with obesity [9, 10]. Since obesity or adiposity and T2DM are the MetS traits, it is expected that genetic variants in FTO may associated with the risks for MetS. The significant association linking MetS and single nucleotide polymorphism (SNP) of FTO rs9939609 was first demonstrated in a study among Caucasian populations [11]. FTO rs9939609 was also observed to have significant association with other MetS components including elevated fasting glucose and triglycerides and low level of HDL cholesterol through elevated body mass index (BMI) [11].

The area of chromosome 19p13, known to be the location of RETN, was recognized by genome-wide linkage analysis (GWLA) to have susceptibility loci for traits associated with MetS [12, 13]. RETN encodes cysteine-rich peptide hormone (resistin) expressed in adipose tissue [14] and was suggested to modulate glucose tolerance and insulin activity, therefore potentially contributes in the pathophysiology of obesity and IR in humans [15,16,17]. Approximately, 70% of the deviation in circulating levels of resistin were described by genetic factors and few SNPs in the RETN itself [18, 19]. Abnormal resistin may induce the onset of obesity-related health conditions such as hypertension, T2DM, and atherosclerosis eventually leads to MetS [20]. Certainly, resistin is considered as a possible inducement and biomarker for the onset of MetS based on its association with obesity, inflammation, IR and comorbidities of CVD [21, 22]. Additionally, few studies found that the GG genotype of RETN rs1862513 was correlated with increased prevalence of MetS [23,24,25,26].

Despite the reported association linking the SNPs of FTO rs9939609 and RETN rs1862513 with MetS as mentioned above, several studies reported null relationship [27,28,29,30,31,32,33]. The interaction between gene and environment is immensely intricate due to various lifestyle characteristics, different environmental conditions or genetic background resulting in such divergence reports. The isolated population of indigenous or named as Orang Asli (OA) of Temiar subtribe located in the Peninsular of Malaysia serves an exceptional chance to study gene-environment interactions as they had undergone the resettlement under a scheme named “Rancangan Penempatan Semula” (RPS) over the last two decades by the government, exposing them to obesogenic environments of modern living. Rare inter-marriage providing an opportunity to observe gene-environment interaction. However, there is no available data reported on the association of both polymorphism with MetS among them. Thus, the present study was undertaken to investigate the association between SNPs of FTO rs9939609 and RETN rs1862513 with the risk of MetS onset among the Temiar subtribe.

Methods

Study subjects

Ethical approval was obtained from Universiti Sultan Zainal Abidin (UniSZA) Human Research Ethics Committee (UHREC) (UHREC/2016/3/012). Participants were invited via the heads of the respective villages via Jabatan Kemajuan Orang Asli (JAKOA). Communication and information with the subject were through JAKOA. Cross sectional study was selected as the study design. Simple random sampling was used where smaller group of the study subjects from the whole Temiar community located at the RPS Kuala Betis in Gua Musang, Kelantan was selected based on termed inclusion and exclusion criteria. The inclusion criteria comprised Temiar subtribe aged 18 years and above from RPS Kuala Betis, Gua Musang in Kelantan, volunteered and agreed to participate in the study. Excluded was subjects who had major psychiatric illness, neurological deficits, and body dysmorphia. One hundred and twenty-three participants who gave written informed consents were recruited. The recruitment of subjects were done gradually with two times visit toward the resettlement. At enrollment, subjects were advised to fast (at least 8 h) prior to actual study procedures. They were then asked to complete a standardized interviewer-based to collect socio-demographics information including age, gender, marital status, educational level, working status, income, family history, tobacco, and alcohol consumption. They were also subjected to anthropometric measurements. All of the included study subjects were then divided into two groups, which are MetS and non-MetS based on modified National Cholesterol Education Program Adult Treatment Panel (NCEP-ATP) III guidelines as described in “Metabolic syndrome” section.

Metabolic syndrome

MetS assessed as per the modified criteria of NCEP-ATP III that requires any three of the following [1]:

  1. I.

    Waist circumference (WC) population-based specific cut-offs; ≥ 90 cm in males, and ≥ 80 cm in females.

  2. II.

    Blood pressure; systolic blood pressure ≥ 130 mmHg and/or diastolic blood pressure ≥ 85 mmHg or current use of antihypertensive drugs.

  3. III.

    Impaired fasting glucose; fasting plasma glucose ≥ 5.6 mmol/L.

  4. IV.

    Triglycerides; ≥ 1.7 mmol/L.

  5. V.

    HDL cholesterol; ≤ 1.03 mmol/L in males and ≤ 1.29 mmol/L in females.

Anthropometric measurements

Anthropometric measurements recorded including blood pressure, weight, height, BMI, and WC. Automated body composition analyzer (Model HBF-36, Karada Scan, Bioelectrical Impedance principle, Omron, Japan) was utilized to evaluate weight and BMI. WC was obtained using a non-stretchable measuring tape to the nearest 0.1 cm. Digital blood pressure monitor (Omron HEM-757, Japan) was used to measure blood pressure in sitting position and on the right arm. Participants were instructed not to eat, exercise, smoke, or climb stairs 30 min prior to blood pressure measurement and were advised to rest (at least 5 min) before the assessment.

Genotyping of FTO rs9939609 and RETN rs1862513 polymorphisms

Commercially available DNA extraction kit, QIAamp DNA Blood Mini kit (Qiagen, Hilden, Germany) was utilized to extract genomic DNA using peripheral blood samples as specified by prescribed protocols. Genotyping for FTO rs9939609 and RETN rs1862513 polymorphisms was employed using Polymerase Chain Reaction–Restriction Fragment Length Polymorphism (PCR–RFLP). The PCR product with the polymorphic sites of FTO and RETN was amplified using appropriate primers (FTO rs9939609 FW: 5′ AGCTGTGAGGAATACTAGGAGA 3′, FTO rs9939609 RV: 5′ ACTCAGCCTCTCTACCATCTTA 3′, RETN rs1862513 FW: 5′ CATTCTCACCCAGAGACATAAT 3′, RETN rs1862513 RV: 5′ CAGCTGTCACTTACCCTCTC 3′) to produce 508 bp and 552 bp fragments, respectively. Amplification was carried out in a total volume of 20 µl containing 1 X GeneAmp PCR Buffer II (Applied Biosystems, California, USA), 0.375 mM dNTPs (Applied Biosystems, California, USA), 1.875 mM MgCl2 (Applied Biosystems, California, USA), 1 unit of AmpliTaq Gold DNA Polymerase (Applied Biosystems, California, USA), 0.5 µM of both forward and reverse specific primers, and 4 ng/µl of DNA template. The PCR protocols were as follows: 96 °C of pre-denaturation for 5 min, 95 °C of denaturation for 1 min, 50 °C for 1 min and 72 °C for 1 min in 40 cycles followed by 72 °C of final extension for 7 min in Veriti™ 96-Well Thermal Cycler (Applied Biosystems, CA, USA). Amplicons were then subjected to electrophoresis at 80 V for 70 min in a 2% agarose gel.

PCR product with the polymorphic site of FTO rs9939609 and RETN rs1862513 was digested using ApoI and BbsI restriction enzymes (New England Biolabs Inc., Ipswich, MA, USA) for 30 min at 37 °C. The homozygous wildtype (T/T) for the SNP of FTO rs9939609 would produce three fragments (182, 173, and 153 bp), while the A-allele would not be digested by ApoI and produced 508 bp fragment. The appearance of four fragments (508, 182, 173 and 153 bp) represented the heterozygous genotype (Fig. 1). Wildtype C allele of RETN rs1862513 was digested with BbsI, to produce a 326 and 226 bp fragments, respectively, with the G allele remaining undigested (552 bp). Heterozygous genotype for RETN rs1862513 polymorphism was confirmed with the presence of three fragments (552, 326, and 226 bp). The genotype was classified as homozygous wildtype (C/C), heterozygous (C/G), and homozygous variant (G/G) according to fragment sizes as shown in Fig. 2. The results for PCR–RFLP genotyping were validated by DNA sequencing based on representative samples.

Fig. 1
figure 1

Representative gel electrophoresis of PCR–RFLP analysis of FTO rs9939609 polymorphism. Lane: M, 100 bp DNA ladder; Lane 1, 3, 4, 5, and 7 are heterozygous genotype (508, 182, 173, and 153 bp); Lane 2, 6, and 8 are homozygous variant genotype (508 bp); Lane 9, homozygous wildtype genotype (182, 173, and 153 bp)

Full size image
Fig. 2
figure 2

Representative gel electrophoresis of PCR–RFLP analysis of RETN rs1862513 polymorphism. Lane: M, 100 bp DNA ladder; Lane 1, 2, and 5 are heterozygous genotype (552, 326, and 226 bp); Lane 3, 4, and 6, homozygous wildtype genotype (326 and 226 bp); Lane 7 and 8 are homozygous variant genotype (552 bp)

Full size image

Statistical analysis

The Chi-square test was utilized to calculate the genotype frequency of FTO rs9939609 and RETN rs1862513 polymorphisms among Temiar with MetS and non-MetS individuals. Descriptive analysis using mean and standard deviation for numerical and continuous variable. Frequency and percentage used for categorical variables. Independent t test was used to compare the mean of all related variables between groups of MetS and non-MetS. Binary logistic regression (SPSS 18.0, IBM Corporation, Armonk, New York, USA) was used to evaluate the Odds Ratios (ORs) and 95% Confidence Interval (CI) of the association risk between FTO rs9939609 and RETN rs1862513 polymorphisms with MetS. All statistical tests were two sided and P < 0.05 was considered as statistically significant.

Results

Of the 123 subjects enrolled, thirty-seven (37) were males and 86 females, and 49 (39.8%) subjects fulfilled the criteria of MetS. The mean age was 40.9 ± 16.6 and 34.5 ± 11.9 years for males and females, respectively. The association between anthropometric measurements and MetS components among the subjects are shown in Table 1. Genotype frequencies of FTO and RETN variants comparing MetS and non-MetS subjects are shown in Table 2.

Table 1 Anthropometric parameters and MetS criteria among study subjects (n = 123)
Full size table
Table 2 Genotype and allele frequencies of FTO rs9939609 and RETN rs1862513 polymorphism in study subjects (n = 123)
Full size table

The ORs for the association between FTO rs9939609 and RETN rs1862513 polymorphisms with susceptibility risk of developing MetS were calculated, where wildtype T/T (FTO rs9939609) and the C/C (RETN rs1862513) were used as a reference genotype. The OR for the occurrence of MetS was 222.5 (P < 0.001) for those having the heterozygous (C/G) genotype and 26.2 (P = 0.005) for those harboring the homozygous (G/G) genotype, at the RETN rs1862513 locus. Homozygous (A/A) genotype and heterozygous (T/A) genotype of FTO rs9939609 polymorphism were also associated with higher risk of developing MetS with OR 19.83 (P < 0.001) and OR 20.7 (P = 0.006), respectively (Table 3).

Table 3 Association of FTO rs9939609 and RETN rs1862513 polymorphisms with MetS susceptibility risk among Temiar subtribe (n = 123)
Full size table

Discussion

MetS is a multifactorial disease with many interrelated factors, such as genetic and environmental factors. There is some urgency in identifying the specific genetic influences on the pathophysiology of MetS. The present study suggested a potential role of FTO and RETN polymorphisms in predisposing individuals to MetS. The studied polymorphisms were found to be associated with higher risk of developing MetS. Our previous finding reported the highest prevalence of MetS among the Temiar subtribe (39.8%) [34] compared to the prevalence reported among major Malaysian populations: 26.4% (Malays), 26.2% (Chinese), and 35.6% (Indians) [35]. The prevalence of MetS was found to be increased with age. Jusoh et al., said that higher MetS prevalence was observed among subjects born after the relocation to RPS compared to the other group, therefore, indicating a distinct relation between the relocation to RPS and the prevalence of MetS among the Temiar subtribe [34]. Despite being a small study, the prevalence observed among this Temiar subtribe is definitely startling, considering the extended results among other substantial populations of relocated OA. Albeit the continuing upgrade of their quality of life and the gradual improvement of long-suffered illnesses, including malnutrition and stunting [20, 36, 37], the establishment of RPS in the Third Malaysia Plan (1976–1980) which previously planned to redevelop and resettle the OA community including the Temiar subtribe, however, has caused them to become vulnerable to non-communicable and lifestyle-related diseases such as MetS and T2DM [38, 39].

The present study indicated higher risk of developing MetS among the Temiar subtribe in association with FTO rs9939609 with compelling odd ratio (OR: 19.83) (Table 3). Temiar subtribe with heterozygous (T/A) has 19-fold increasing risk of developing MetS, while 20-fold of increasing risk to develop MetS was reported with homozygous variant (A/A) compared to the Temiar subtribe with homozygous wildtype (T/T). The present finding was in agreement with previous GWAS among Caucasian [11] and non-Caucasian multi-ethnics [27] where increasing risk of developing MetS was observed among A-allele carriers of FTO rs9939609. Previous studies also reported significant associations between FTO rs9939609 and MetS among subjects in Southern Italy, Xinjiang and Tunisia [40,41,42]. However, few studies failed to demonstrate the association between FTO rs9939609 and MetS [43, 44]. It is known that obesity (reflects by BMI) and adiposity specifically visceral obesity (reflects by waist circumference) are acknowledged as parts of MetS components. In contrast to those without MetS, WC and BMI were significantly higher among the Temiar subtribe with MetS [34]. Indeed, BMI was reported as an independent predictor for MetS [34]. Hence, it is apparent that adiposity or visceral obesity is the intermediate implication in the association of the FTO rs9939609 and the development of MetS.

It is reported that the FTO's overexpression in mice would cause obesity and elevated adiposity level [45]. FTO influences the biological activity through the effects on the DNA methylation [46]. FTO is predominantly expressed in hypothalamus, suggesting that FTO plays crucial biological activity in the hypothalamic controlling the food intake [45], energy homeostasis [47], cerebrocortical regulation of insulin [48], and body fat regulation through adipocyte lipolysis [49]. It is also suggested that FTO might crucially regulated sympathetic nervous system, modulating the cardiovascular system and blood pressure [50]. While precise function of FTO in the mechanism of human obesity and MetS remains debatable, FTO is the most identified genetic loci for frequent form of obesity. Reports on the risk association of FTO with obesity and its related traits, however, were inconsistent [30, 51,52,53,54]. Obesity has a fundamental contribution in MetS progression. The risk association of FTO rs9939609 in MetS observed in this study was in line with a large meta-analysis among Asian and European populations [55]. However, several studies were reported to contradict the observation [27,28,29].

The present study also indicated a higher risk of developing MetS with RETN rs1862513 polymorphism among the Temiar subtribe with a captivating odd ratio (OR: 222.55) (Table 3). Subjects with heterozygous (C/G) have two-hundred-twenty-two-fold increasing risk of developing MetS. In contrast, twenty-six-fold of increasing risk to develop MetS was reported among them with homozygous variant (G/G) compared to subjects with homozygous wildtype (T/T). Significant associations between RETN rs1862513 and MetS were also reported in studies among Japanese population [25, 26], but no such association was observed in a study among Malaysian men [31]. RETN rs1862513 polymorphism was found to be associated with the regulation of RETN expression and serum resistin level [56,57,58]. Resistin expression is induced during adipocyte differentiation, while in mature adipocytes, it is down-regulated, but is overexpressed in obesity [59, 60]. A recent study has reported a significant association between higher serum resistin level in GG carriers compared to CC and CG carriers of RETN rs1862513 polymorphism [61]. Albeit being reported as a controversial finding [62], such association was also reported in previous studies among Korean [56] and Malaysian population [63].

This phenomenon probably resulted from elevated resistin promoter activity found with the G allele [56, 58]. Evidently, the G allele serves as a binding site for Sp1 and Sp3 transcription factors, where the binding of the factors was observed to elevate the resistin promoter activity [58]. The SNP rs1862513 has a real sequel on resistin expression, but the capacity of resistin in human obesity via the effect of RETN rs1862513 remains to be elucidated. Higher serum resistin level was acknowledged to be linked with increased obesity, visceral fat, IR and T2DM [64, 65]. The serum resistin level is closely linked to metabolic disorders and the onset of MetS itself. A clinical finding supported the association observing the increment of serum resistin level among adults with MetS, likened to those without MetS [66]. The Temiar subtribe was also reported to have a direct correlation between serum resistin with most of MetS components including visceral obesity, increasing fasting glucose and triglycerides levels. However, the HDL cholesterol was inversely correlated with the resistin level [67]. Correspondingly, serum resistin level was reported to be an independent predictor for MetS among the Temiar subtribe [34]. The RETN rs1862513 polymorphism was also observed to be linked with risk of MetS components including visceral obesity, and increased BMI, total cholesterol, and low-density-lipoprotein levels [69]. However, no such association was reported among Malaysian [30], Han Chinese [68], Tunisian [69], and Thais [70].

Nonetheless, the main limitation of this study was the small sample size. Their refusal to consent for blood specimens, the accessibility to the Temiars due to remote location, the layered procedures to recruit the Temiars, which involved OA officials and the Temiars village heads, as well as budget constraint are among the anticipated causative factors for the low response rate. Although the best efforts were made to ensure correct understanding on the procedures and requirements to the subjects, we regret that there might be a possibility of poorly complied subjects to the overnight fasting instruction.

Conclusion

It is possible to postulate that the impact of genetic factors predisposes human to a disease was diverse across numerous ethnic populations and depends on various lifestyle or cultural characteristics and different environmental conditions. Therefore, the disparity among findings were reported among studies. The study subjects and its setting minimized the genetic background noises considering the Temiars living in a very close-knit society and tend to marry each other. Thus, the genetic admixture is reduced. The present study suggested a significant role of FTO rs9939609 and RETN rs1862513 polymorphisms in predisposing the Temiars to develop MetS with captivating high odds ratios. Further studies are necessary with larger sample size consisting of other ethnic groups with similar background to confirm the genetic influences in the development of MetS.

Availability of data and materials

Not applicable.

Abbreviations

BMI:

Body mass index

CI:

Confidence interval

CVD:

Cardiovascular disease

DNA:

Deoxyribonucleic acid

dNTPs:

Deoxyribose nucleotide triphosphate

FTO:

Fat mass and obesity associated

GWAS:

Genome-wide association studies

GWLA:

Genome-wide linkage analysis

HDL:

High-density lipoprotein

JAKOA:

Jabatan Kemajuan Orang Asli

MetS:

Metabolic syndrome

MgCl2 :

Magnesium chloride

NCEP-ATP III:

National Cholesterol Education Program Adult Treatment Panel-III

OA:

Orang Asli

OR:

Odd ratio

PCR:

Polymerase Chain Reaction

PCR–RFLP:

Polymerase Chain Reaction–Restriction Fragment Length Polymorphism

RPS:

Rancangan Penempatan Semula

SNP:

Single nucleotide polymorphism

SPSS:

Statistical Packages for the Social Sciences

T2DM:

Type 2 diabetes mellitus

UHREC:

UniSZA Human Research Ethics Committee

UniSZA:

Universiti Sultan Zainal Abidin

WC:

Waist circumference

References

  1. Grundy SM, Hansen B, Smith SC Jr, Cleeman JI, Kahn RA (2004) Conference Participants. Clinical management of metabolic syndrome: report of the American Heart Association/National Heart, Lung, and Blood Institute/American Diabetes Association conference on scientific issues related to management. Circulation 109(4):551–556. https://doi.org/10.1161/01.CIR.0000112379.88385.67

    Article  PubMed  Google Scholar 

  2. Alberti KG, Eckel RH, Grundy SM, Zimmet PZ, Cleeman JI, Donato KA, Fruchart JC, James WP, Loria CM, Smith SC Jr (2009) Harmonizing the metabolic syndrome: a joint interim statement of the international diabetes federation task force on epidemiology and prevention; national heart, lung, and blood institute; American heart association; world heart federation; international atherosclerosis society; and international association for the study of obesity. Circulation 120(16):1640–1645. https://doi.org/10.1161/CIRCULATIONAHA.109.192644

    Article  CAS  PubMed  Google Scholar 

  3. Eckel RH, Grundy SM, Zimmet PZ (2005) The metabolic syndrome. Lancet 365(9468):1415–1428. https://doi.org/10.1016/S0140-6736(05)66378-7

    Article  CAS  PubMed  Google Scholar 

  4. Wassink AM, Olijhoek JK, Visseren FL (2007) The metabolic syndrome: metabolic changes with vascular consequences. Eur J Clin Invest 37(1):8–17. https://doi.org/10.1111/j.1365-2362.2007.01755.x

    Article  CAS  PubMed  Google Scholar 

  5. Zabaneh D, Balding DJ (2010) A genome-wide association study of the metabolic syndrome in Indian Asian men. PLoS ONE 5(8):e11961. https://doi.org/10.1371/journal.pone.0011961

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Pollex RL, Hegele RA (2006) Genetic determinants of the metabolic syndrome. Nat Clin Pract Cardiovasc Med 3(9):482–489. https://doi.org/10.1038/ncpcardio0638

    Article  CAS  PubMed  Google Scholar 

  7. Guettier JM, Georgopoulos A, Tsai MY, Radha V, Shanthirani S, Deepa R, Gross M, Rao G, Mohan V (2005) Polymorphisms in the fatty acid-binding protein 2 and apolipoprotein C-III genes are associated with the metabolic syndrome and dyslipidemia in a South Indian population. J Clin Endocrinol Metab 90(3):1705–1711. https://doi.org/10.1210/jc.2004-1338

    Article  CAS  PubMed  Google Scholar 

  8. Lin HF, Boden-Albala B, Juo SH, Park N, Rundek T, Sacco RL (2005) Heritabilities of the metabolic syndrome and its components in the Northern Manhattan Family Study. Diabetologia 48(10):2006–2012. https://doi.org/10.1007/s00125-005-1892-2

    Article  PubMed  PubMed Central  Google Scholar 

  9. Dina C, Meyre D, Gallina S, Durand E, Körner A, Jacobson P, Carlsson LM, Kiess W, Vatin V, Lecoeur C, Delplanque J (2007) Variation in FTO contributes to childhood obesity and severe adult obesity. Nat Genet 39(6):724–726. https://doi.org/10.1038/ng2048

    Article  CAS  PubMed  Google Scholar 

  10. Frayling TM, Timpson NJ, Weedon MN, Zeggini E, Freathy RM, Lindgren CM, Perry JR, Elliott KS, Lango H, Rayner NW, Shields B (2007) A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 316(5826):889–894. https://doi.org/10.1126/science.1141634

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Freathy RM, Timpson NJ, Lawlor DA, Pouta A, Ben-Shlomo Y, Ruokonen A, Ebrahim S, Shields B, Zeggini E, Weedon MN, Lindgren CM, Lango H, Melzer D, Ferrucci L, Paolisso G, Neville MJ, Karpe F, Palmer CN, Morris AD, Elliott P, Jarvelin MR, Smith GD, McCarthy MI, Hattersley AT, Frayling TM (2008) Common variation in the FTO gene alters diabetes-related metabolic traits to the extent expected given its effect on BMI. Diabetes 57(5):1419–1426. https://doi.org/10.2337/db07-1466

    Article  CAS  PubMed  Google Scholar 

  12. Malhotra A, Elbein SC, Ng MC, Duggirala R, Arya R, Imperatore G, Adeyemo A, Pollin TI, Hsueh WC, Chan JC, Rotimi C, Hanson RL, Hasstedt SJ, Wolford JK (2007) Meta-analysis of genome-wide linkage studies of quantitative lipid traits in families ascertained for type 2 diabetes. Diabetes 56(3):890–896. https://doi.org/10.2337/db06-1057

    Article  CAS  PubMed  Google Scholar 

  13. Heijmans BT, Beekman M, Putter H, Lakenberg N, van der Wijk HJ, Whitfield JB, Posthuma D, Pedersen NL, Martin NG, Boomsma DI, Slagboom PE (2005) Meta-analysis of four new genome scans for lipid parameters and analysis of positional candidates in positive linkage regions. Eur J Hum Genet 13(10):1143–1153. https://doi.org/10.1038/sj.ejhg.5201466

    Article  CAS  PubMed  Google Scholar 

  14. Wang H, Chu WS, Hemphill C, Elbein SC (2002) Human resistin gene: molecular scanning and evaluation of association with insulin sensitivity and type 2 diabetes in Caucasians. J Clin Endocrinol Metab 87(6):2520–2524. https://doi.org/10.1210/jcem.87.6.8528

    Article  CAS  PubMed  Google Scholar 

  15. Wang Y, Zhang D, Liu Y, Yang Y, Zhao T, Xu J, Li S, Zhang Z, Feng G, He L, Xu H (2009) Association study of the single nucleotide polymorphisms in adiponectin-associated genes with type 2 diabetes in Han Chinese. J Genet Genomics 36(7):417–423. https://doi.org/10.1016/S1673-8527(08)60131-9

    Article  CAS  PubMed  Google Scholar 

  16. Chu S, Ding W, Li K, Pang Y, Tang C (2008) Plasma resistin associated with myocardium injury in patients with acute coronary syndrome. Circ J 72(8):1249–1253. https://doi.org/10.1253/circj.72.1249

    Article  CAS  PubMed  Google Scholar 

  17. Hu WL, Qiao SB, Hou Q, Yuan JS (2007) Plasma resistin is increased in patients with unstable angina. Chin Med J (Engl) 120(10):871–875

    Article  CAS  PubMed  Google Scholar 

  18. Cao H, Hegele RA (2001) Single nucleotide polymorphisms of the resistin (RSTN) gene. J Hum Genet 46(9):553–555. https://doi.org/10.1007/s100380170040

    Article  CAS  PubMed  Google Scholar 

  19. Engert JC, Vohl MC, Williams SM, Lepage P, Loredo-Osti JC, Faith J, Doré C, Renaud Y, Burtt NP, Villeneuve A, Hirschhorn JN, Altshuler D, Groop LC, Després JP, Gaudet D, Hudson TJ (2002) 5’ flanking variants of resistin are associated with obesity. Diabetes 51(5):1629–1634. https://doi.org/10.2337/diabetes.51.5.1629

    Article  CAS  PubMed  Google Scholar 

  20. Lim H, Chee H (1998) Nutritional status and reproductive health of Orang Asli women in two villages in Kuantan, Pahang. Malays J Nutr 4(1):31–54

    CAS  PubMed  Google Scholar 

  21. Asgary S, SamsamShariat SZ, Ghorbani A, Keshvari M, Sahebkar A, Sarrafzadegan N (2015) Relationship between serum resistin concentrations with metabolic syndrome and its components in an Iranian population. Diabetes Metab Syndr 9(4):266–270. https://doi.org/10.1016/j.dsx.2014.09.007

    Article  PubMed  Google Scholar 

  22. Gupta V, Singh AK, Gupta V, Kumar S, Srivastava N, Jafar T, Pant AB (2011) Association of circulating resistin with metabolic risk factors in Indian females having metabolic syndrome. Toxicol Int 18(2):168–172. https://doi.org/10.4103/0971-6580.84272

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Norata GD, Ongari M, Garlaschelli K, Raselli S, Grigore L, Catapano AL (2007) Plasma resistin levels correlate with determinants of the metabolic syndrome. Eur J Endocrinol 156(2):279–284. https://doi.org/10.1530/eje.1.02338

    Article  CAS  PubMed  Google Scholar 

  24. Kumar S, Gupta V, Srivastava N, Gupta V, Mishra S, Mishra S, Natu Shankar M, Roy U, Chandra A, Negi MP, Kumar S (2014) Resistin 420C/G gene polymorphism on circulating resistin, metabolic risk factors and insulin resistance in adult women. Immunol Lett 162(2 Pt B):287–291. https://doi.org/10.1016/j.imlet.2014.07.009

    Article  CAS  PubMed  Google Scholar 

  25. Miyamoto Y, Morisaki H, Kokubo Y, Yamanaka I, Tomoike H, Okayama A, Yoshimasa Y, Morisaki T (2009) Resistin gene variations are associated with the metabolic syndrome in Japanese men. Obes Res Clin Pract 3(2):I–II. https://doi.org/10.1016/j.orcp.2008.11.003

    Article  PubMed  Google Scholar 

  26. Ochi M, Osawa H, Hirota Y, Hara K, Tabara Y, Tokuyama Y, Shimizu I, Kanatsuka A, Fujii Y, Ohashi J, Miki T, Nakamura N, Kadowaki T, Itakura M, Kasuga M, Makino H (2007) Frequency of the G/G genotype of resistin single nucleotide polymorphism at − 420 appears to be increased in younger-onset type 2 diabetes. Diabetes 56(11):2834–2838. https://doi.org/10.2337/db06-1157

    Article  CAS  PubMed  Google Scholar 

  27. Al-Attar SA, Pollex RL, Ban MR, Young TK, Bjerregaard P, Anand SS, Yusuf S, Zinman B, Harris SB, Hanley AJ, Connelly PW, Huff MW, Hegele RA (2008) Association between the FTO rs9939609 polymorphism and the metabolic syndrome in a non-Caucasian multi-ethnic sample. Cardiovasc Diabetol 7:5. https://doi.org/10.1186/1475-2840-7-5

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Attaoua R, Ait El Mkadem S, Lautier C, Kaouache S, Renard E, Brun JF, Fedou C, Gris JC, Bringer J, Grigorescu F (2009) Association of the FTO gene with obesity and the metabolic syndrome is independent of the IRS-2 gene in the female population of Southern France. Diabetes Metab 35(6):476–483. https://doi.org/10.1016/j.diabet.2009.07.002

    Article  CAS  PubMed  Google Scholar 

  29. Ranjith N, Pegoraro RJ, Shanmugam R (2011) Obesity-associated genetic variants in young Asian Indians with the metabolic syndrome and myocardial infarction. Cardiovasc J Afr 22(1):25–30. https://doi.org/10.5830/cvja-2010-036

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Wang T, Huang Y, Xiao XH, Wang DM, Diao CM, Zhang F, Xu LL, Zhang YB, Li WH, Zhang LL, Zhang Y, Sun XF, Zhang Q (2010) The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese. Chin Med J (Engl) 123(14):1852–1858

    CAS  PubMed  Google Scholar 

  31. Lau CH, Muniandy S (2011) Adiponectin and resistin gene polymorphisms in association with their respective adipokine levels. Ann Hum Genet 75(3):370–382. https://doi.org/10.1111/j.1469-1809.2010.00635.x

    Article  CAS  PubMed  Google Scholar 

  32. Qasim AN, Metkus TS, Tadesse M, Lehrke M, Restine S, Wolfe ML, Hannenhalli S, Cappola T, Rader DJ, Reilly MP (2009) Resistin gene variation is associated with systemic inflammation but not plasma adipokine levels, metabolic syndrome or coronary atherosclerosis in nondiabetic Caucasians. Clin Endocrinol (Oxf) 70(5):698–705. https://doi.org/10.1111/j.1365-2265.2008.03375.x

    Article  CAS  PubMed  Google Scholar 

  33. Ma X, Warram JH, Trischitta V, Doria A (2002) Genetic variants at the resistin locus and risk of type 2 diabetes in Caucasians. J Clin Endocrinol Metab 87(9):4407–4410. https://doi.org/10.1210/jc.2002-020109

    Article  CAS  PubMed  Google Scholar 

  34. Jusoh AF, Harun NS, Yahaya R, Him NA, Ismail R, Rohin MA, Ridzwan NH, Jumli MN, Zahary MN (2021) Prevalence and risk factors in metabolic syndrome among Temiar in Kelantan. Int J Diabetes Dev Ctries 41(2):228–234. https://doi.org/10.1007/s13410-020-00903-7

    Article  Google Scholar 

  35. Rampal S, Mahadeva S, Guallar E, Bulgiba A, Mohamed R, Rahmat R, Arif MT, Rampal L (2012) Ethnic differences in the prevalence of metabolic syndrome: results from a multi-ethnic population-based survey in Malaysia. PLoS ONE 7(9):e46365. https://doi.org/10.1371/journal.pone.0046365

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Law LS, Sulaiman N, Gan WY, Adznam SN, Mohd Taib MN (2020) Predictors of overweight and obesity and its consequences among Senoi Orang Asli (indigenous people) women in Perak, Malaysia. Int J Environ Res Public Health 17(7):2354

    Article  PubMed  PubMed Central  Google Scholar 

  37. Haemamalar K, Zalilah MS, Neng Azhanie A (2010) Nutritional status of Orang Asli (Che Wong Tribe) adults in Krau Wildlife Reserve, Pahang. Malays J Nutr 16(1)

  38. Tuan Abdul Aziz TA, Teh LK, Md Idris MH, Bannur Z, Ashari LS, Ismail AI, Ahmad A, Isa KM, Nor FM, Rahman TH, Shaari SA, Jan Mohamed HJ, Mohamad N, Salleh MZ (2016) Increased risks of cardiovascular diseases and insulin resistance among the Orang Asli in Peninsular Malaysia. BMC Public Health 16:284. https://doi.org/10.1186/s12889-016-2848-9

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Lim KG, Cheah WK (2016) A review of metabolic syndrome research in Malaysia. Med J Malaysia 71(Suppl 1):20–28

    CAS  PubMed  Google Scholar 

  40. Liguori R, Labruna G, Alfieri A, Martone D, Farinaro E, Contaldo F, Sacchetti L, Pasanisi F, Buono P (2014) The FTO gene polymorphism (rs9939609) is associated with metabolic syndrome in morbidly obese subjects from southern Italy. Mol Cell Probes 28(4):195–199. https://doi.org/10.1016/j.mcp.2014.03.004

    Article  CAS  PubMed  Google Scholar 

  41. Hu YH, Liu JM, Zhang M, Ma RL, Guo H, Wang K, He J, Yan YZ, Rui DS, Sun F, Mu LT, Niu Q, Ding YS, Zhang JY, Li SG, Guo SX (2015) Association between polymorphisms of fat mass and obesity-associated gene and metabolic syndrome in Kazakh adults of Xinjiang, China. Genet Mol Res 14(4):14597–14606. https://doi.org/10.4238/2015.November.18.23

    Article  CAS  PubMed  Google Scholar 

  42. Elouej S, Nagara M, Attaoua R, Sallem OK, Rejeb I, Hsouna S, Lasram K, Halim NB, Chargui M, Jamoussi H, Turki Z, Kamoun I, Belfki-Benali H, Abid A, Slama CB, Bahri S, Triki D, Romdhane HB, Abdelhak S, Kefi R, Grigorescu F (2016) Association of genetic variants in the FTO gene with metabolic syndrome: a case-control study in the Tunisian population. J Diabetes Complicat 30(2):206–211. https://doi.org/10.1016/j.jdiacomp.2015.11.013

    Article  Google Scholar 

  43. Shimaoka I, Kamide K, Ohishi M, Katsuya T, Akasaka H, Saitoh S, Sugimoto K, Oguro R, Congrains A, Fujisawa T, Shimamoto K, Ogihara T, Rakugi H (2010) Association of gene polymorphism of the fat-mass and obesity-associated gene with insulin resistance in Japanese. Hypertens Res Off J Jpn Soc Hypertens 33(3):214–218. https://doi.org/10.1038/hr.2009.215

    Article  CAS  Google Scholar 

  44. Liem ET, Vonk JM, Sauer PJ, van der Steege G, Oosterom E, Stolk RP, Snieder H (2010) Influence of common variants near INSIG2, in FTO, and near MC4R genes on overweight and the metabolic profile in adolescence: the TRAILS (TRacking Adolescents’ Individual Lives Survey) Study. Am J Clin Nutr 91(2):321–328. https://doi.org/10.3945/ajcn.2009.28186

    Article  CAS  PubMed  Google Scholar 

  45. Church C, Moir L, McMurray F, Girard C, Banks GT, Teboul L, Wells S, Brüning JC, Nolan PM, Ashcroft FM, Cox RD (2010) Overexpression of Fto leads to increased food intake and results in obesity. Nat Genet 42(12):1086–1092. https://doi.org/10.1038/ng.713

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  46. Wu Q, Saunders RA, Szkudlarek-Mikho M, Serna Ide L, Chin KV (2010) The obesity-associated FTO gene is a transcriptional coactivator. Biochem Biophys Res Commun 401(3):390–395. https://doi.org/10.1016/j.bbrc.2010.09.064

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Gerken T, Girard CA, Tung YC, Webby CJ, Saudek V, Hewitson KS, Yeo GS, McDonough MA, Cunliffe S, McNeill LA, Galvanovskis J, Rorsman P, Robins P, Prieur X, Coll AP, Ma M, Jovanovic Z, Farooqi IS, Sedgwick B, Barroso I, Lindahl T, Ponting CP, Ashcroft FM, O’Rahilly S, Schofield CJ (2007) The obesity-associated FTO gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase. Science 318(5855):1469–1472. https://doi.org/10.1126/science.1151710

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Tschritter O, Preissl H, Yokoyama Y, Machicao F, Häring HU, Fritsche A (2007) Variation in the FTO gene locus is associated with cerebrocortical insulin resistance in humans. Diabetologia 50(12):2602–2603. https://doi.org/10.1007/s00125-007-0839-1

    Article  CAS  PubMed  Google Scholar 

  49. Wåhlén K, Sjölin E, Hoffstedt J (2008) The common rs9939609 gene variant of the fat mass- and obesity-associated gene FTO is related to fat cell lipolysis. J Lipid Res 49(3):607–611. https://doi.org/10.1194/jlr.M700448-JLR200

    Article  CAS  PubMed  Google Scholar 

  50. Fawcett KA, Barroso I (2010) The genetics of obesity: FTO leads the way. Trends Genet 26(6):266–274. https://doi.org/10.1016/j.tig.2010.02.006

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Scuteri A, Sanna S, Chen WM, Uda M, Albai G, Strait J, Najjar S, Nagaraja R, Orrú M, Usala G, Dei M, Lai S, Maschio A, Busonero F, Mulas A, Ehret GB, Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakatta E, Abecasis GR (2007) Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits. PLoS Genet 3(7):e115. https://doi.org/10.1371/journal.pgen.0030115

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Song Y, You NC, Hsu YH, Howard BV, Langer RD, Manson JE, Nathan L, Niu T, Tinker FL, Liu S (2008) FTO polymorphisms are associated with obesity but not diabetes risk in postmenopausal women. Obesity (Silver Spring) 16(11):2472–2480. https://doi.org/10.1038/oby.2008.408

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  53. Li H, Wu Y, Loos RJ, Hu FB, Liu Y, Wang J, Yu Z, Lin X (2008) Variants in the fat mass- and obesity-associated (FTO) gene are not associated with obesity in a Chinese Han population. Diabetes 57(1):264–268. https://doi.org/10.2337/db07-1130

    Article  CAS  PubMed  Google Scholar 

  54. Apalasamy YD, Ming MF, Rampal S, Bulgiba A, Mohamed Z (2012) Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays. Braz J Med Biol Res 45(12):1119–1126. https://doi.org/10.1590/s0100-879x2012007500134

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Zhou D, Liu H, Zhou M, Wang S, Zhang J, Liao L, He F (2012) Common variant (rs9939609) in the FTO gene is associated with metabolic syndrome. Mol Biol Rep 39(6):6555–6561. https://doi.org/10.1007/s11033-012-1484-4

    Article  CAS  PubMed  Google Scholar 

  56. Cho YM, Youn BS, Chung SS, Kim KW, Lee HK, Yu KY, Park HJ, Shin HD, Park KS (2004) Common genetic polymorphisms in the promoter of resistin gene are major determinants of plasma resistin concentrations in humans. Diabetologia 47(3):559–565. https://doi.org/10.1007/s00125-003-1319-x

    Article  CAS  PubMed  Google Scholar 

  57. Azuma K, Oguchi S, Matsubara Y, Mamizuka T, Murata M, Kikuchi H, Watanabe K, Katsukawa F, Yamazaki H, Shimada A, Saruta T (2004) Novel resistin promoter polymorphisms: association with serum resistin level in Japanese obese individuals. Horm Metab Res 36(8):564–570. https://doi.org/10.1055/s-2004-825762

    Article  CAS  PubMed  Google Scholar 

  58. Osawa H, Yamada K, Onuma H, Murakami A, Ochi M, Kawata H, Nishimiya T, Niiya T, Shimizu I, Nishida W, Hashiramoto M, Kanatsuka A, Fujii Y, Ohashi J, Makino H (2004) The G/G genotype of a resistin single-nucleotide polymorphism at − 420 increases type 2 diabetes mellitus susceptibility by inducing promoter activity through specific binding of Sp1/3. Am J Hum Genet 75(4):678–686. https://doi.org/10.1086/424761

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Bokarewa M, Nagaev I, Dahlberg L, Smith U, Tarkowski A (2005) Resistin, an adipokine with potent proinflammatory properties. J Immunol 174(9):5789–5795. https://doi.org/10.4049/jimmunol.174.9.5789

    Article  CAS  PubMed  Google Scholar 

  60. Patel SP, Raju PA (2013) Resistin in serum and gingival crevicular fluid as a marker of periodontal inflammation and its correlation with single-nucleotide polymorphism in human resistin gene at − 420. Contemp Clin Dent 4(2):192–197. https://doi.org/10.4103/0976-237X.114878

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Zayani N, Hamdouni H, Boumaiza I, Achour O, Neffati F, Omezzine A, Najjar MF, Bouslama A (2018) Resistin polymorphims, plasma resistin levels and obesity in Tunisian volunteers. J Clin Lab Anal 32(2):e22227. https://doi.org/10.1002/jcla.22227

    Article  CAS  PubMed  Google Scholar 

  62. Menzaghi C, Coco A, Salvemini L, Thompson R, De Cosmo S, Doria A, Trischitta V (2006) Heritability of serum resistin and its genetic correlation with insulin resistance-related features in nondiabetic Caucasians. J Clin Endocrinol Metab 91(7):2792–2795. https://doi.org/10.1210/jc.2005-2715

    Article  CAS  PubMed  Google Scholar 

  63. Apalasamy YD, Rampal S, Salim A, Moy FM, Su TT, Majid HA, Bulgiba A, Mohamed Z (2015) Polymorphisms of the resistin gene and their association with obesity and resistin levels in Malaysian Malays. Biochem Genet 53(4–6):120–131. https://doi.org/10.1007/s10528-015-9678-9

    Article  CAS  PubMed  Google Scholar 

  64. Schäffler A, Schölmerich J, Büchler C (2005) Mechanisms of disease: adipocytokines and visceral adipose tissue—emerging role in nonalcoholic fatty liver disease. Nat Clin Pract Gastroenterol Hepatol 2(6):273–280. https://doi.org/10.1038/ncpgasthep0186

    Article  CAS  PubMed  Google Scholar 

  65. Hillebrand JJG, Geary N (2010) Do leptin and insulin signal adiposity? Forum Nutr 63:111–122. https://doi.org/10.1159/000264399

    Article  CAS  PubMed  Google Scholar 

  66. Aquilante CL, Kosmiski LA, Knutsen SD, Zineh I (2008) Relationship between plasma resistin concentrations, inflammatory chemokines, and components of the metabolic syndrome in adults. Metabolism 57(4):494–501. https://doi.org/10.1016/j.metabol.2007.11.010

    Article  CAS  PubMed  Google Scholar 

  67. Zahary MN, Harun NS, Yahaya R, Nik Him NAS, Rohin MAK, Ridzwan NH, Jumli MN, Wan Jusoh AF (2019) Serum adiponectin and resistin: correlation with metabolic syndrome and its associated criteria among temiar subtribe in Malaysia. Diabetes Metab Syndr 13(3):2015–2019. https://doi.org/10.1016/j.dsx.2019.04.048

    Article  PubMed  Google Scholar 

  68. Fu Y, Yu Y, Wu Y, You Y, Zhang Y, Kou C (2017) Association between two resistin gene polymorphisms and metabolic syndrome in Jilin, Northeast China: a case-control study. Dis Markers 2017:1638769. https://doi.org/10.1155/2017/1638769

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  69. Boumaiza I, Omezzine A, Rejeb J, Rebhi L, Ben Rejeb N, Nabli N, Ben Abdelaziz A, Bouslama A (2012) Association between four resistin polymorphisms, obesity, and metabolic syndrome parameters in Tunisian volunteers. Genet Test Mol Biomark 16(12):1356–1362. https://doi.org/10.1089/gtmb.2012.0156

    Article  CAS  Google Scholar 

  70. Suriyaprom K, Tungtrongchitr R, Namjuntra P (2015) Associations of resistin levels with resistin gene polymorphism and metabolic syndrome in Thais. J Med Biochem 34(2):170–178. https://doi.org/10.2478/jomb-2014-0034

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

The authors would like to express the gratitude to the Ministry of Higher Education for the research funding (RAGS/1/2015/SKK01/UNISZA/03/1), Jabatan Kemajuan Orang Asli (JAKOA) for the technical, logistic and staffs support, the Temiar subtribe in Kuala Betis, Gua Musang, Kelantan for their enthusiasm to involve in this study.

Funding

Research Acculturation Grant Scheme (RAGS) (RAGS/1/2015/SKK01/UNISZA/03/1).

Author information

Authors and Affiliations

  1. Faculty of Health Sciences, Universiti Sultan Zainal Abidin, Gong Badak Campus, 21300, Kuala Nerus, Terengganu, Malaysia

    Nur Sakinah Harun, Mohd Adzim Khalili Rohin & Mohd Nizam Zahary

  2. Faculty of Medicine, Universiti Sultan Zainal Abidin, Medical Campus, 20400, Kuala Terengganu, Terengganu, Malaysia

    Azizul Fadzli Wan Jusoh, Rosliza Yahaya & Nik Ahmad Shaifuddin Nik Him

Authors
  1. Nur Sakinah Harun
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Azizul Fadzli Wan Jusoh
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mohd Adzim Khalili Rohin
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Rosliza Yahaya
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Nik Ahmad Shaifuddin Nik Him
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Mohd Nizam Zahary
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

NSH, MNZ and AFWJ performed writing, analyzing and interpreting data, collected samples as well as performed the research. MAKR, RY and NASNH analyzed and collected samples. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mohd Nizam Zahary.

Ethics declarations

Ethics approval and consent to participate

Ethical approval was obtained from UniSZA Human Research Ethics Committee (UHREC) (UHREC/2016/3/012). All subjects gave consent to participate. Personal, demographic details and relevant data of the participants were collected and recorded after getting informed consent as in the patient information and consent form provided in Additional files 1, 2, 3 and 4.

Consent for publication

All authors gave consent to publish the paper.

Competing interests

The authors declared that they have no competing of interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1.

Ethical approval from UniSZA Human Research Ethics Committee (UHREC).

Additional file 2.

Patient Information and Consent Form.

Additional file 3.

Approval from Jabatan Kemajuan Orang Asli (JAKOA) for data collection.

Additional file 4.

Sample of consent form signed by research participants.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Harun, N.S., Wan Jusoh, A.F., Rohin, M.A.K. et al. The contribution of FTO rs9939609 and RETN rs1862513 polymorphisms in predisposing resettled indigenous (Orang Asli) Temiar to metabolic syndrome. Egypt J Med Hum Genet 24, 44 (2023). https://doi.org/10.1186/s43042-023-00425-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43042-023-00425-x

Keywords