Skip to main content
Egyptian Journal of Medical Human Genetics
Download PDF

Association of insertion/deletion (I/D) polymorphism of angiotensin-converting enzyme gene (ACE) with Parkinson’s disease and factors risk in eastern Algeria: case–control study

Egyptian Journal of Medical Human Genetics volume 25, Article number: 66 (2024) Cite this article

Abstract

Background

This study aimed to explore the relationship between Parkinson’s disease and insertion/deletion polymorphism (I/D) of the angiotensin-converting enzyme gene (ACE) and to highlight the related risk factors within Eastern Algerian population. A total of 262 individuals were recruited, including 100 PD patients and 162 controls. Polymerase chain reaction technique was employed to determine the ACE polymorphism genotype of each participant. Logistic regression analysis was conducted to examine factors potentially contributing to Parkinson’s disease.

Results

The mean age of onset of Parkinson’s disease in the patient group was 56.18 \(\pm 12.99\). The results revealed that the D allele of the angiotensin-converting enzyme gene and the DD genotype were most prevalent in both patients and controls. However, there were no significant differences in the genotype and allele frequencies of the I/D polymorphism of the angiotensin-converting enzyme gene between patients and healthy subjects. Cardiovascular disease, diabetes and profession were identified as potential risk factors for Parkinson’s disease.

Conclusion

The obtained data indicated no correlation between the angiotensin-converting enzyme I/D gene polymorphism and Parkinson’s disease in our research cohort. Multiple logistic regression analysis revealed that cardiovascular disease, diabetes and profession were possible risk factors for Parkinson’s disease.

Background

Parkinson’s disease is a chronic, neurological, degenerative disorder, characterized by the progressive loss of dopamine neurons, located in a brain region known as the substantia nigra [1]. There is a potential link between this neurodegeneration and a chronic inflammatory process [2]. The clinical manifestations of PD encompass both motor signs (such as resting tremor, bradykinesia, muscle rigidity and postural instability) and non-motor signs (such as apathy, constipation, and sleep problems) [3]. While there is currently no definitive cure for PD, ongoing research explores novel therapeutic approaches, including neuron substitution, apomorphine, and α-synuclein interventions to alleviate or limit symptoms [4]. It is now well established that both genetic susceptibility and environmental factors significantly contribute to the development of PD [1]. Although the majority of PD cases are idiopathic, around 10% are attributed to inherited genetic mutations. Variations in susceptibility genes elevate the risk of developing PD [5]. Among these genes, ACE may play an essential role in PD development [6]. The Renin-Angiotensin System (RAS), a crucial regulator of blood pressure, is highly dependent on ACE. ACE primarily converts Angiotensin I (Ang I) into Angiotensin II (Ang II). The interaction of Ang II with its receptor induces potent vasoconstriction and triggers profibrotic, proapoptotic, and proinflammatory pathways in various organs [7]. Additionally, ACE plays a vital role in the degradation of bradykinin, a peptide controlling vascular tone [8]. Elevated ACE concentrations have been identified in the basal ganglia and nigrostriatal pathway. ACE also deactivates substance P, a neuropeptide prevalent in the basal ganglia, the loss of which has been linked to the etiology of several neurological disorders, including PD [9].

The ACE gene, located on chromosome 17q23, comprises 26 exons and 25 introns. The ACE I/D polymorphism results from the insertion or deletion of a 287-base pairs (bp) Alu repeated fragment in intron 16, leading to three genotypes: ID, DD, and II [10]. Previous studies on the association between the ACE I/D gene polymorphism and PD risk have yielded conflicting results. While one case–control analysis suggested a potential link [8], other studies found no evidence supporting an association [6, 11]. Consequently, the existing evidence on the association between ACE polymorphism and PD is inconclusive, necessitating further research for clarification of this relationship. Our case–control study aims to explore the correlation between I/D polymorphism of the ACE gene and PD within Eastern Algerian population. Additionally, the study seeks to identify potential risk factors associated with PD.

Methods

ACE I/D genotyping

A volume of 5 millilitres to 8 millilitres of venous blood was collected in vacutainer tubes containing Ethylene DiaminoTetraacetic Acid (EDTA). This blood was intended for Deoxyribonucleic acid (DNA) extraction from blood leukocytes using the sodium chloride (NaCl) method as referred to by Miller et al. [12]. A polymerase chain reaction (PCR) assay was applied to identify ACE polymorphism genotypes. The primers for the ACE gene were as follows: forward 5′CTGGAGACCACTCCCATCCTTTCT3′ and reverse 5′GATGTGGCCATCACATTCGTCAGAT3. The PCR technique was performed in a 10 μL volume of the mix containing template DNA, MgCl2 (50 mM), deoxynucleotide triphosphate (dNTPs) mix (final concentration 0.2 mmol/L), and oligonucleotide primers (100 ng/μL). Amplification of DNA samples was performed as follows: predenaturation at 94 °C for 5 min, followed by 35 cycles. Each cycle contained a denaturation at 94 °C for 30 s, annealing at 56 °C for 45 s and primer extension at 72 °C for 30 s. At the end of the cycles a final extension occurred at 72 °C for 7 min. PCR products of size 490 bp (allele I) and 190 bp (allele D) were separated using 2% agarose gel electrophoresis with ethidium bromide and viewed under ultraviolet light.

Statistical analysis

Statistical analyses were performed using IBM SPSS software (version 25.0; Spss Inc., Chicago, IL., U.S.A). Descriptive statistics and frequency analyses were used for the initial characterization Mean ± standard deviation (SD) was used for continuous data, while frequencies and percentages were used for categorical data. To investigate variations in the frequency of ACE gene alleles and genotypes between individuals with PD and control groups, the chi-square X2 test was utilized. The chi-square test for goodness of fit was used to assess the validity of the genotype distributions within the two groups matching the predictions of Hardy–Weinberg equilibrium (HWE). Multiple logistic regression analysis was also performed to investigate the association between the homozygote DD genotype and potential risk factors related to PD. A significance level of P < 0.05 was used in all statistical analyses.

Results

The ethnic origin of Parkinson’s cases and controls was consistent. The mean age of onset for PD was 56.18 ± 12.99 years, while healthy subjects had a mean age of 59.40 ± 11.47 years. Additionally, the sex ratio in patients with PD was 1.17, and in controls, it was 1.10. Examination of the characteristics of patients and controls revealed associations between PD and hypertension, as well as diabetes (p = 0.004, p < 0.001), respectively. Moreover, profession was also correlated to PD (p = 0.021). Manual labor (33.8%), particularly in masonry and cement, administration (20%) and education (10.8%) were the most prevalent professions in our patient group (Table 1).

Table 1 Characteristics of patients and controls
Full size table

No significant variations were observed in the distribution of II, DD, and ID genotypes across all members of the study cohort. However, the homozygote DD genotype was the most prevalent among both patients (81%) and controls (84%). Additionally, the D allele was more common in both groups; nevertheless, there was no statistically significant result (OR = 0.82, 95% CI = 0.46–1.47, p = 0.133). The population analyzed in this study was in Hardy–Weinberg equilibrium. Furthermore, a comparison was conducted between carriers of PD with and without the homozygous DD genotype. Among those with the DD genotype, 81% were PD patients and 84% were healthy cases, while the remaining 19% of PD patients and 16% of healthy cases did not possess the DD genotype (DI and II genotypes) (Table 2).

Table 2 Genotype and allele frequencies of ACEI/D polymorphism in patients and controls
Full size table

Additionally, the logistic regression analysis with various possible confounding factors indicated that the DD genotype was not significantly associated to PD (OR = 1.34, 95% CI = 0.65–2.76).

According to the results of this regression analysis, cardiovascular disease (OR = 7.52, 95% CI = 1.27–44.53), diabetes (OR = 3.80, 95% CI = 1.32–10.88) and profession (OR = 2.97, 95% CI = 1.53–5.74) were potential risk factors for PD. Nevertheless, no statistically significant correlations were found with the other factors (Table 3).

Table 3 The odds ratio and confidence interval of multiple potential risk factors of PD
Full size table

To conduct a further analysis, the distribution of the DD genotype among patients and controls was compared by classifying them by age range (< 50, 50–59, 60–69, and ≥ 70 years). According to our results, the DD genotype was more common in the 60–69 age group in PD patients, while it was more frequent in the 50–59 age group among control subjects. Additionally, we divided the population into two age ranges (< 60 and ≥ 60) and indicated the increased frequency of the DD genotype in both patient and control groups among those less than 60 years old. However, overall, our findings indicated that the differences in genotype distribution, in each age group, did not demonstrate statistical significance (Table 4).

Table 4 Comparison of DD genotype of ACE I/D polymorphism in patients and controls classified by age range
Full size table

ACE, angiotensin-converting enzyme; I/D, insertion/deletion; PD, Parkinson’s disease; n, number; X2, chi-square test.

Discussion

Our objective in this study was to explore the potential correlation between the ACE I/D gene polymorphism and PD within the Eastern Algerian population, involving 100 PD patients and 162 controls. Additionally, we aimed to evaluate various risk factors associated with PD development and determine if any associations existed among them.

Literature research revealed a correlation between hypertension and PD, consistent with our results. A meta-analysis of various cohort studies suggested that hypertension may contribute as a risk factor for the motor stage of PD diagnosis [13]. Another systematic review reported altered blood pressure patterns in individuals with PD, associated with an unfavorable prognosis [14]. However, findings from a case–control study indicated that hypertension reduces the risk of PD by 0.2 times in the general population but elevates the risk by 1.9 times in the Asian population [15]. Additionally, a meta-analysis of analytical studies suggested that hypertension might augment the likelihood of developing PD [16]. Further research is necessary for a comprehensive understanding of the intricate relationship between hypertension and PD.

Regarding cardiovascular disease, it has been reported that people with PD have a high risk of developing cardiovascular disease during the follow-up period [17]. Furthermore, PD treatments, including levodopa, anticholinergic agents, and dopamine agonists, are also responsible for cardiovascular adverse effects. However, more studies need to be conducted to clarify the underlying mechanisms [18]. Our findings also revealed a significant correlation between the development of PD and cardiovascular disease.

According to a review study, PD and diabetes are related. Both conditions are becoming more common worldwide and are particularly linked to aging. In addition to increasing the risk of PD, diabetes and insulin resistance may impact the progression of PD symptoms. Importantly, antidiabetic treatments have shown a neuroprotective effect in diabetic and non-diabetic parkinsonian patients [19]. A meta-analysis highlighted diabetes' impact on PD clinical progression and pathophysiological mechanisms, including protein misfolding, oxidative stress, neuroinflammation, and mitochondrial dysfunction [20]. A nationwide cohort study indicated that the severe form of diabetes may be a risk factor for PD [21]. In our study, we observed a significant correlation between PD and diabetes, aligning with the findings of the previously mentioned investigations.

The current analysis revealed that profession was a significant risk factor for PD (OR = 2.97). The most prevalent occupations in our patient group included manual labor (particularly in masonry and cement), administration and education. Tanner et al. [22] found that engaging in occupations, such as agriculture, education, healthcare, or welding, did not increase the risk of Parkinsonism. Conversely, the use of pesticides in one’s occupation was associated with an almost 80% higher risk of developing PD. Additionally, a case–control study identified associations between PD and professions, such as teaching and healthcare services [23], Torti et al. [24] suggested that professions like pilots and physicians might have an etiological role in PD. Nevertheless, the choice of profession has been linked to the risk of PD. According to Darweech et al. [25] study, the risk of PD seems to vary based on the chosen profession, with artistic occupations associated with a lower risk and conventional occupations potentially linked to a higher risk. The study suggests that dopaminergic degeneration might influence occupational choices, possibly beginning in the pre-diagnostic phase of PD.

The allele frequencies and genotypes of patients compared to controls did not show any significant differences in the genetic study. Mellick et al. [26] proposed the potential significance of the ACE gene in PD development within the Caucasian population. Their findings indicated that ID was the most frequent genotype (52% in patients and 56% in control), but the distribution of genotypes did not differ between both groups. The D and I allele frequencies were also identical among parkin2sonian patients and healthy subjects. Our results align with Mellick et al., indicating that the ACE I/D variant does not correlate with PD pathogenesis. However, in our study, the most frequent genotype was DD (81% in patients and 84% in control), and the D allele represented the highest frequency (D 89% and I 11%) in the patient group.

Lin et al. [27] also evaluated the impact of ACE I/D polymorphism on PD in a Chinese population. They revealed that the DD genotype was more frequent in patients (22% versus 12% in control), with a statistically significant difference (p = 0.048). Although the D allele was more frequent in PD patients, significance was not reached (p = 0.133). In Chinese and Caucasians controls, the frequencies of the D allele are 35–39% and 50–58%, respectively, but in normal Italians, there is 67% [27, 28]. Our findings were different from previous results (D 91%). Greek and Italian populations similarly showed that the distribution of genotypes was not statistically significant between patients and healthy subjects [8]. In their studies, the most frequent genotype was ID. A Colombian study also revealed no association, consistent with our results. However, their findings demonstrated the ID genotype as the most common [29]. The difference in significance between our study and others could be explained by various factors, including our African ethnicity, lifestyle, exposure to environmental agents, or a mix of these factors.

Conclusion

This case–control study aimed to assess the association between the ACE I/D gene polymorphism and PD within the Eastern Algerian population, alongside the identification of associated risk factors. The finding of this investigation revealed no significant association between PD and the ACE I/D gene polymorphism. The application of multiple logistic regression analysis identified cardiovascular disease, diabetes, and profession as potential risk factors for PD. Importantly, this study represents the initial exploration of this relationship within the Eastern Algerian population. It is crucial to acknowledge that further investigations with larger sample sizes, diverse Algerian populations, and various ethnic groups are imperative to validate our findings and gain a deeper understanding of the potential implications of this polymorphism in PD.

Availability of data and material

The data utilized and/or examined during the current study are available the corresponding author on reasonable request.

Abbreviations

ACE :

Angiotensin converting enzyme

Ang I:

Angiotensin I

Ang II:

Angiotensin II

Bp:

Base pairs

CI:

Confidence interval

DNA:

Deoxyribonucleic acid

dNTPs:

Deoxynucleotide triphosphate

EDTA:

Ethylene diamino tetraacetic Acid

I/D:

Insertion/deletion

HWE:

Hardy Weinberg equilibrium

NaCl:

Sodium chloride

n:

Number

OR:

Odds ratios

PCR:

Polymerase chain reaction

PD:

Parkinson’s disease

RAS:

Renin Angiotensin system

SD:

Standard deviation

References

  1. Tansey MG, Wallings RL, Houser MC, Herrick MK, Keating CE, Joers V (2022) Inflammation and immune dysfunction in Parkinson disease. Nat Rev Immunol 22(11):657–673

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Ulhaq ZS, Garcia CP (2020) Inflammation-related gene polymorphisms associated with Parkinson’s disease: an updated meta-analysis. Egypt J Med Hum Genet 21:1–10

    Article  Google Scholar 

  3. Sveinbjornsdottir S (2016) The clinical symptoms of Parkinson’s disease. J Neurochem 139:318–324

    Article  CAS  PubMed  Google Scholar 

  4. Uwishema O, Onyeaka H, Badri R, Yücel AN, Korkusuz AK, Ajagbe AO et al (2022) The understanding of Parkinson’s disease through genetics and new therapies. Brain Behav 12(5):e2577

    Article  PubMed  PubMed Central  Google Scholar 

  5. Rocha EM, Keeney MT, Di Maio R, De Miranda BR, Greenamyre JT (2022) LRRK2 and idiopathic Parkinson’s disease. Trends Neurosci 45(3):224–236

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Pascale E, Purcaro C, Passarelli E, Guglielmi R, Vestri AR, Passarelli F et al (2009) Genetic polymorphism of Angiotensin-Converting Enzyme is not associated with the development of Parkinson’s disease and of L-dopa-induced adverse effects. J Neurol Sci 276(1–2):18–21

    Article  CAS  PubMed  Google Scholar 

  7. El-Sayed Marei Y, Abdallah Bayoumy A, Mohamed Abulazm Nassar H, Mansour B, Bakeir Hamady A (2023) The relation between ACE gene polymorphism and the severity of COVID-19 infection. Int J Microbiol. 2023:4540287

    Article  PubMed  PubMed Central  Google Scholar 

  8. Papapetropoulos S, Glynos K, Zhou Z, Orfanos SE, Mitsi G, Papapetropoulos A (2008) The insertion/deletion polymorphism of the angiotensin converting enzyme (ACE) in Parkinson’s disease. Open Neurol J 2:66

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Campbell DJ (2003) The renin–angiotensin and the kallikrein–kinin systems. Int J Biochem Cell Biol 35(6):784–791

    Article  CAS  PubMed  Google Scholar 

  10. Thakur S, Sharma V, Kaur D, Purkait P (2022) Angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism as a conjoint regulator of coagulation, fibrinolytic, and RAAS pathway in infertility and associated pregnancy complications. J Renin Angiotensin Aldosterone Syst. https://doi.org/10.1155/2022/1695769

    Article  PubMed  PubMed Central  Google Scholar 

  11. Su G, Dou H, Zhao L, Wang H, Liu G, Huang B et al (2015) The angiotensin-converting enzyme (ACE) I/D polymorphism in Parkinson’s disease. J Renin Angiotensin Aldosterone Syst 16(2):428–433

    Article  CAS  PubMed  Google Scholar 

  12. Miller SA, Dykes DD, Polesky H (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucl Acids Res 16(3):1215

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Hou L, Li Q, Jiang L, Qiu H, Geng C, Hong J-S et al (2018) Hypertension and diagnosis of Parkinson’s disease: a meta-analysis of cohort studies. Front Neurol 9:162

    Article  PubMed  PubMed Central  Google Scholar 

  14. Tulbă D, Cozma L, Bălănescu P, Buzea A, Băicuș C, Popescu BO (2021) Blood pressure patterns in patients with Parkinson’s disease: a systematic review. J Personal Med 11(2):129

    Article  Google Scholar 

  15. Ng Y-F, Ng E, Lim E-W, Prakash KM, Tan LC, Tan E-K (2021) Case-control study of hypertension and Parkinson’s disease. npj Parkinson’s Dis. 7(1):63

    Article  Google Scholar 

  16. Chen J, Zhang C, Wu Y, Zhang D (2019) Association between hypertension and the risk of Parkinson’s disease: a meta-analysis of analytical studies. Neuroepidemiology 52(3–4):181–192

    Article  PubMed  Google Scholar 

  17. Hong CT, Hu H-H, Chan L, Bai C-H (2018) Prevalent cerebrovascular and cardiovascular disease in people with Parkinson’s disease: a meta-analysis. Clin Epidemiol 10:1147–1154

    Article  PubMed  PubMed Central  Google Scholar 

  18. Grosu L, Grosu AI, Crisan D, Zlibut A, Perju-Dumbrava L (2023) Parkinson’s disease and cardiovascular involvement: edifying insights. Biomed Rep 18(3):1–8

    Article  Google Scholar 

  19. Labandeira CM, Fraga-Bau A, Ron DA, Alvarez-Rodriguez E, Vicente-Alba P, Lago-Garma J et al (2022) Parkinson’s disease and diabetes mellitus: common mechanisms and treatment repurposing. Neural Regen Res 17(8):1652

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Hassan A, Kandel RS, Mishra R, Gautam J, Alaref A, Jahan N (2020) Diabetes mellitus and Parkinson’s disease: shared pathophysiological links and possible therapeutic implications. Cureus. https://doi.org/10.7759/cureus.9853

    Article  PubMed  PubMed Central  Google Scholar 

  21. Han K, Kim B, Lee SH, Kim MK (2023) A nationwide cohort study on diabetes severity and risk of Parkinson disease. Npj Parkinson’s Dis. 9(1):11

    Article  Google Scholar 

  22. Tanner CM, Ross GW, Jewell SA, Hauser RA, Jankovic J, Factor SA et al (2009) Occupation and risk of parkinsonism: a multicenter case-control study. Arch Neurol 66(9):1106–1113

    Article  PubMed  Google Scholar 

  23. Tsui JK, Calne DB, Wang Y, Schulzer M, Marion SA (1999) Occupational risk factors in Parkinson’s disease. Can J Public Health 90:334–337

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Torti M, Fossati C, Casali M, De Pandis MF, Grassini P, Radicati FG et al (2020) Effect of family history, occupation and diet on the risk of Parkinson disease: a case-control study. PLoS ONE 15(12):e0243612

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Darweesh S, Ikram M, Faber M, De Vries N, Haaxma CA, Hofman A et al (2018) Professional occupation and the risk of Parkinson’s disease. Eur J Neurol 25(12):1470–1476

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Mellick G, Buchanan D, McCann S, Davis D, Le Couteur D, Chan D et al (1999) The ACE deletion polymorphism is not associated with Parkinson’s disease. Eur Neurol 41(2):103–106

    Article  CAS  PubMed  Google Scholar 

  27. Lin J-J, Yueh K-C, Chang D-C, Lin S-Z (2002) Association between genetic polymorphism of angiotensin-converting enzyme gene and Parkinson’s disease. J Neurol Sci 199(1–2):25–29

    Article  CAS  PubMed  Google Scholar 

  28. Castellano M, Glorioso N, Cusi D, Sarzani R, Fabris B, Opocher G et al (2003) Genetic polymorphism of the renin–angiotensin–aldosterone system and arterial hypertension in the Italian population: the GENIPER project. J Hypertens 21(10):1853–1860

    Article  CAS  PubMed  Google Scholar 

  29. Benitez BA, Forero DA, Arboleda GH, Granados LA, Yunis JJ, Fernandez W et al (2010) Exploration of genetic susceptibility factors for Parkinson’s disease in a South American sample. J Genet 89(2):229

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

We acknowledge Madam Yasmina Dadci member of the Laboratory of Biology and Molecular Genetics of University Hospital Ibn Badis Constantine for DNA extraction.

Funding

Not applicable.

Author information

Authors and Affiliations

  1. Laboratory of Molecular and Cellular Biology, Department of Animal Biology, Faculty of Life and Natural Sciences, University of Mentouri Constantine1, Constantine, Algeria

    Horchi-Mekkaoui Meroua, Achou Rayene, Laouar Rania, Gharzouli Razika & Satta Dalila

  2. LIRE Laboratory, Constantine, Algeria

    Djoudi Brahim

  3. University of Mentouri Constantine1, Constantine, Algeria

    Djoudi Brahim

  4. Neurology Service, University Hospital Ibn Badis, Constantine, Algeria

    Taghane Naima

  5. Laboratory of Biology and Molecular Genetics, Faculty of Medicine, University of Constantine 3, Constantine, Algeria

    Abadi Noureddine

Authors
  1. Horchi-Mekkaoui Meroua
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Achou Rayene
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Djoudi Brahim
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Laouar Rania
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Gharzouli Razika
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Taghane Naima
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Abadi Noureddine
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Satta Dalila
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

H-M.M collected and analyzed the data, realized the PCR method and wrote the manuscript. A.R participated in data collection and realization of PCR. D.I carried out statistical analysis. LR participated in data collection and helped in the revision of the manuscript. G.R participated in the revision of the work. TN, AN provided detailed clinical and examined patients. SD helped in making this study, revised and approved the manuscript.

Corresponding author

Correspondence to Horchi-Mekkaoui Meroua.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the ethical Scientific Committee of the Faculty of Sciences of Nature and Life of the University of the Mentouri Constantine 1, Algeria. The work has been carried out in accordance with the usual accepted protocol, the ethical principles of the Declaration of Helsinki and the Algerian legislation on the protection of privacy and experimentation on the human person. A Consent form was obtained from all study cohort.

Consent for publication

Consent form was obtained from the participants for publication.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Meroua, HM., Rayene, A., Brahim, D. et al. Association of insertion/deletion (I/D) polymorphism of angiotensin-converting enzyme gene (ACE) with Parkinson’s disease and factors risk in eastern Algeria: case–control study. Egypt J Med Hum Genet 25, 66 (2024). https://doi.org/10.1186/s43042-024-00536-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43042-024-00536-z

Keywords