Skip to main content
Egyptian Journal of Medical Human Genetics
Download PDF

Study of the relationship between genetic variants of IL-18 and the occurrence of inflammatory bowel disease

Egyptian Journal of Medical Human Genetics volume 25, Article number: 81 (2024) Cite this article

Abstract

Background

A member of the Interleukin-1 superfamily of cytokines, interleukin-18 (IL-18) is essential to the etiology and progression of inflammatory bowel disease (IBD), a chronic inflammatory illness that affects the digestive system. This study investigated the possible association between two genetic variations, IL-18 rs187238 and IL-18 rs1946518, and IBD in Iraqi patients.

Methods

We evaluated the association of two SNPs of the IL-18 gene at rs187238 and rs1946518 in 54 IBD patients with 19 Crohn’s disease (CD), 35 ulcerative colitis (UC), and 46 healthy controls using PCR-RFLP and PCR-AS techniques for detecting IL-18 rs187238 and IL-18 rs1946518, respectively, by extracting genomic DNA from blood samples.

Results

Our findings indicated no statistically significant variations between the IL-18 rs187238 genotypes and incidences of CD and UC (P = 0.189 and 0.59, respectively). However, the allele frequency showed a significant difference with CD (P = 0.049) but did not show a significant association with UC (P = 0.887). There was no significant association between the genotype and allele frequency of IL-18 rs1946518C/A and CD risk (P = 0.171 and 0.053, respectively). However, there was a significant association between the genotype and allele frequency of IL-18 rs1946518C/A and the risk of developing UC (P = 0.028 and 0.002, respectively).

Conclusion

The study revealed statistically significant distinctions between the genetic and allelic frequencies of IL-18 rs1946518 and the probability of developing UC. Nonetheless, there were no significant distinctions between them and CD. According to the research, there were no major differences between IL-18 rs187238 and the two diseases. The frequency of the C allele is connected to CD.

Introduction

Inflammatory Bowel Disease (IBD) is a chronic intestinal inflammation caused by host-microbial interactions that affect genetically vulnerable individuals. It is characterized by inflammation of the small and large intestines, with CD and UC being Its two primary forms. Typical symptoms include diarrhea, abdominal pain, bloody stools, vomiting, and defects in the intestinal epithelium’s barrier function [1, 2]. UC affects the colon, whereas CD can affect any part of the gastrointestinal tract [3]. Individuals of all genders and ages can manifest CD and UC. Adopting a Western lifestyle contributes to an annual increase in IBD. Experts anticipate a significant increase in the prevalence of IBD in the coming years [4]. Although the exact etiology of IBD has not been thoroughly understood, research indicates that genetics, immune response, environmental factors, and microbiology potentially contribute to its development [5]. The immune system in the gastrointestinal tract interacts with gastrointestinal microbes to maintain balance and prevent IBD [6]. IBD is a chronic inflammatory disorder with a polygenic nature, and a considerable number of genetic loci associated with IBD have been discovered to date [7]. However, understanding these loci’s molecular and pathogenic mechanisms has been limited, mainly focusing on coding variants [8]. Genetic research has identified 163 susceptibility loci for IBD, with significant overlap between CD and UC [9]. The development of IBD is influenced by multiple genes, which likely contribute to the disease’s progression through various pathways [10].

Gene polymorphisms in proinflammatory cytokines, such as IL-1, IL-6, IL-8, and IL-18, may increase the risk of IBD by altering the levels of these inflammatory chemicals. These genetic polymorphisms may lead to increased production of pro-inflammatory cytokines, thereby generating an inflammatory milieu that may contribute to the development of IBD [11]. Cytokines play a major role in the immunopathogenesis of IBD. In IBD, an imbalance between pro- and anti-inflammatory cytokines results in tissue damage, illness development, and impaired resolution of inflammation. Additionally, several unique cytokines have been linked to the etiology of IBD [12]. CD is associated with Th1 and Th17 conditions, producing IL-12, IL-23, IFN-γ, and IL-17, whereas UC is associated with Th2 and Th9 conditions and produces IL-13, IL-5, and IL-9 [13]. The roles of cytokines in maintaining mucosal health and developing diseases are increasingly being elucidated. Such insights are invaluable for understanding the mechanisms underlying gut inflammation and can facilitate the development of reliable diagnostic and prognostic biomarkers and cytokine-specific therapeutic interventions [14].

The human IL-18 gene is on chromosome 11q22.2-22.3 and includes six exons and five introns [15]. To date, three single nucleotide polymorphisms(SNPs) in the promoter region of IL-18 gene have been identified, including rs1946519 (-656G/T), -607C/A, and -137G/C [16, 17]. IL-18 is a cytokine that aids in combating infections and controlling the immune system. It is possible that high IL-18 levels can cause inflammation and autoimmune disorders in individuals with specific immune-related illnesses, such as rheumatoid arthritis, systemic lupus erythematosus, type I diabetes mellitus, atopic dermatitis, psoriasis, and IBD[18]. Additionally, a meta-analysis identified a substantial difference in the genotype frequency of the IL-18 rs187238 SNP between patients with CD and population-based controls [11]. The results of the previous meta-analysis indicated that IL-8 rs4073, IL-10 rs1800871, IL-10 rs1800872, IL-10 rs1800896, and IL-18 rs1946518 polymorphisms may impact the risk of developing IBD. Furthermore, IL-18 rs187238 polymorphism may affect CD but not UC susceptibility [19]. This study aimed to investigate the correlation between two variants of the IL-18 gene (rs1946518 C/A and rs187238 G/C) and their impact on the risk of inflammatory bowel disease in the Babylon province population of Iraq using PCR-RFLP and PCR-AS techniques for the detection of IL-18 rs187238 and IL-18 rs1946518, respectively.

Materials and methods

Blood samples collection

A total of 54 patients diagnosed with inflammatory bowel disease were included in this study. The patients were from the Center for Digestive Diseases and Surgery in Marjan Medical City, Babylon Province, Iraq. Samples were collected between March and September 2023 from 34 males and 20 females aged 14–63 years. In addition, 46 samples were collected from individuals in good health, consisting of 38 males and 8 females between the ages of 17 and 68. To distinguish polymorphisms of the IL-18 gene, 2.5 ml of whole blood samples was obtained from each patient with CD or UC and from healthy individuals (as a control group) in anticoagulant EDTA tubes.

DNA extraction process

Genomic DNA was isolated from refrigerated blood samples using the highly recognized gSYAN DNA kit manufactured by Geneaid, an established company in the United States. The method used for extraction followed rigorously the complete guidelines provided by the manufacturer to ensure accuracy. Following the successful completion of the extraction procedure, the acquired DNA underwent an extensive evaluation to determine its concentration ng/µL, in addition to its purity. The essential analysis was performed using a nanodrop spectrophotometer, particularly the THERMO-manufactured model, which is a reputable company in the United States. The evaluation included a thorough analysis of the absorbance measurements at 260/280 nm wavelengths, which yielded vital information on the quality and integrity of the extracted DNA.

Detection of IL-18 rs187238G/C

PCR-RFLP technique was used to perform the genotyping of the IL-18 rs187238G/C SNP. The primer (Table 1) was used to genotype the polymorphism. To amplify IL-18 rs187238G/C, a reaction mixture of 20 µL was prepared with 1 µL of each primer (forward primer (G allele), reverse primer (C allele), 12.5 µL of the Promega G2 green master mix, 5 µL of (5–50 ng) isolated DNA, and 13 µL of DNase-free water. This PCR-RFLP method was previously described by [20]. We amplified the IL-18 rs187238 gene using the thermal cycling procedure. The procedure started with 35 cycles of initial denaturation at 95 °C for 5 min. Every cycle lasted 30 s at 95 °C for denaturation, 30 s at 94 °C for annealing, and 30 s at 58 °C for elongation. The last elongation phase lasted five min at 72 °C. In the following amplification, IL-18 rs187238G/C site was the only target of HinfI-enzymatic digestion. The amplified result was then examined on a 3% agarose gel. Gel electrophoresis was performed for 60 min under UV illumination with an electric current of 75 V and 20 mA.

Table 1 Sequence, amplicon size, and the restriction enzyme designed for IL-18 rs187238G/C variant [20]
Full size table

Detection of IL-18 rs1946518C/A

In this study, we designed PCR-AS primers for the IL-18-rs1946518 C/A gene polymorphism using the NCBI SNP Database and the WASP Web-based Allele Specific Primer design tool. Table 2 lists the primers provided to us by Scientific Researcher Co. Ltd. in Iraq. To prepare the PCR-AS master mix, a GoTaq® G2 Green Master Mix kit was used. Each sample was subjected to two reactions: a wild-type AS-PCR allele reaction mixture and a mutant-type AS-PCR allele reaction mix. To prepare the wild-type AS-PCR allele reaction mix, a 25 µL mixture was made using 2 μL of each primer (wild-type primer and common reverse primer), 12.5 µL of the Promega G2 green master mix, 5 µL of (5–50 ng) isolated DNA, and 3.5 µL of DNase-free water. Similarly, to prepare the mutant-type AS-PCR allele reaction mix, a 25 µL mixture was made using 2 µL of each primer (wild-type primer and common reverse primer), 12.5 µL of the Promega G2 green master mix, 5 µL of (5–50 ng) isolated DNA, and 3.5 µL of DNase-free water. The manufacturer’s instructions were followed precisely in executing all steps. Using thermal cycling, we amplified the IL-18 rs1946518 SNP. The procedure started with 35 cycles of initial denaturation at 95 °C for 5 min. Every cycle lasted 30 s at 95 °C for denaturation, 30 s at 94 °C for annealing, and 30 s at 58 °C for extension. The last extension phase lasted five min at 72 °C. On a 2% agarose gel, the amplified product was then examined. Under UV illumination, gel electrophoresis was carried out for 60 min with an electric current of 75 V and 20 mA.

Table 2 PCR-AS Primers for IL-18-rs1946518 C/A and their sequence and amplicon sizes (Scientific Researcher Co. Ltd. in Iraq)
Full size table

DNA sequencing

Sanger sequencing was conducted to validate the genotyping analysis for gene polymorphisms. IL-18 rs187238 G/C was amplified using the newly designed flanked regions DNA sequencing primers F: (GGAGGAAGGGGAAGTCCTGA) and R: (TTCCTTGCTGACTGTCCAGG). In addition, IL-18 rs1946518 C/A was amplified using the newly designed flanked regions DNA sequencing primers F: (TCCCTGACTCTAGGAACCCC) and R: (TCCTGGTCACACTTCAGCAC) in samples from three healthy controls and five patients with IBD for each SNP. The PCR products were sent to Macrogen Company in Korea via DHL, packed in ice bags, for DNA sequencing. DNA was sequenced using the Applied Biosystems (AB) DNA sequencing system.

Statistical analysis

Data collection, summary, analysis, and presentation were conducted using the Statistical Software for Social Sciences (SPSS) version 26 and Microsoft Office LTCS Professional Plus 2021. To explore the connections between categorical variables and analyze data that follows both normal and non-normal distributions, we used statistical techniques such as the t-test for independent samples and chi-square analysis.

Results

DNA extraction

Genomic DNA from blood samples was extracted using the gSYAN DNA kit extraction kit (Frozen Blood) Geneaid and checked by using a nanodrop spectrophotometer at 260/280 nm, ranging from 1.8 to 2.2, with a purity average of 2. The DNA concentration mean was 20 ng/μl.

Detection of IL-18 rs187238 genetic variation

The distribution of the IL-18 rs187238 polymorphism was identified using the PCR-RFLP technique. Three genotypes are found at this locus: GG, GC, and CC. Figure 1 shows the PCR-RFLP product investigation of the IL-18-rs187238G/C SNP using the HinfI restriction enzyme. It was conducted on a 3% agarose gel at 75 V and 20 mA for 60 min. The DNA marker (M) size ranges from 1000 to 50 base pairs. When the product is undigested by the restriction enzyme, it appears as a single band at 149 base pairs in the lane, representing the mutant-type homozygote (CC). In contrast, when the restriction enzyme digests the product, it appears as two distinct bands at 107 and 42 base pairs, respectively, in the lane for the wild-type homozygote (GG). Lastly, the lane representing the heterozygote (GC) displays three distinct bands at 149 base pairs, 107 base pairs, and 42 base pairs, respectively, since the restriction enzyme also digests the product.

Fig. 1
figure 1

A 3% agarose gel electrophoresis showed the PCR-RFLP product analysis of IL-18-rs187238 G/C gene polymorphism using the HinfI restriction enzyme at 75 V and 20 mA for 60 min. Where M: marker (1000-50 bp). Lane (CC) mutant-type homozygote, the product undigested by restriction enzyme and still 149 bp band. Lane (GG) wild-type homozygote was digested by restriction enzyme into 107 bp band and 42 bp band. Lane (GC) heterozygote, the product digested by restriction enzyme into 149 bp, 107 bp, and 42 bp bands

Full size image

To ensure the accuracy of the results, we randomly selected eight samples for sequencing, which included five samples from patients with IBD and three samples from healthy individuals. The findings, presented in Fig. 2, showed that all samples of healthy individuals with the GG genotype were homozygous for the wild-type allele of the rs187238 SNP, with two copies of the IL-18 gene containing a G base at the SNP position. On the other hand, two IBD samples were homozygous for the mutant allele of the rs187238 SNP, with both copies of the IL-18 gene containing a C base at the SNP position; one IBD sample had the GG genotype, indicating that it was homozygous for the wild-type allele of the rs187238 SNP; and two IBD samples had the G/C genotype, indicating that they were heterozygous for the rs187238 SNP, with one copy of the IL-18 gene containing a G base at the SNP location and the other containing a C base. These results strongly suggest that the rs187238 SNP plays a role in milder forms of IBD, and other genetic factors may also be contributing to IBD.

Fig. 2
figure 2

Sequence analysis of the IL-18 rs187238 gene polymorphism was performed, including wild-type GG homozygotes containing two copies of the G allele, mutant CC homozygotes containing two copies of the C allele, and GC heterozygotes containing one copy of the G allele and a copy of the C allele, on eight randomly selected samples. The reference allele G is black, while the mutant allele C is blue

Full size image

The distribution of genotypes (GG, GC, and CC) for the IL-18 rs187238 gene within the control group was assessed using the Hardy–Weinberg equation (HWE). These findings are displayed in Table 3. Within the control cohort, 33 out of 46 individuals exhibited the homozygous wild genotype GG, while 11 out of 46 individuals displayed the heterozygous GC genotype. Furthermore, the homozygous mutant CC genotype was observed in 2 out of 46 individuals. Notably, the observed distribution of control subjects based on IL-18 rs187238 genotypes did not significantly deviate from the expected distribution (P = 0.702).

Table 3 HWE for the control group
Full size table

Genotypic and allelic analysis of IL-18 rs187238 between Crohn’s disease patients and the control group

The comparison of genotype and allele frequency of the IL-18 rs187238 SNP between healthy controls and CD patients is presented in Table 4. Concerning the mode of genotypes, a statistically insignificant distinction was observed in the distribution of genotypes between individuals who were in good health and those who had CD (P = 0.189). According to a risk study, there was no significant risk associated with the heterozygous G/C genotypes (OR = 1.8) or the homozygous CC genotypes (OR = 4.95). Based on these odds ratios, homozygous CC genotype carriers maybe five times more likely to develop the condition. However, the risk analysis revealed that the C allele’s frequency was a significant risk factor (P = 0.049; OR = 2.37), indicating that individuals who carried a higher frequency of the C allele were at greater risk of acquiring the disease.

Table 4 IL-18 rs187238 genotype and allele frequency in Patients with CD and healthy control
Full size table

Genotypic and allelic analysis for IL-18 rs187238 in ulcerative colitis patients and healthy control

The analysis of genotypes and frequencies of alleles in connection to the IL-18 rs187238 SNP among individuals with UC and those without any disease is introduced in Table 5. In terms of the genotyping mode, P = 0.559 indicates that there were insignificant distinctions in the frequency analysis of genotype between UC patients and controls who were healthy. Patients with the heterozygous CC genotype are almost twice as likely to develop the condition as those with other genotypes, according to risk analysis, which showed that the homozygous CC genotype was a non-significant risk factor (OR = 1.94).

Table 5 IL-18 rs187238 genotype and allele frequency in Patients with UC and healthy control
Full size table

Detection of IL-18 rs1946518 polymorphism

The technique known as PCR-AS was utilized to identify the presence of the IL-18 rs1946518 polymorphism and its distribution. Within this particular locus, three genotypes were observed: CC, CA, and AA. Utilizing 2% agarose gel electrophoresis, the PCR-AS product analysis of the IL-18-rs1946518 C/A gene polymorphism was conducted at 75 V with a 20 mA current for a duration of 60 min. The DNA ladder marker (M) ranged from 2000 to 100 bp. The C allele solely represented the wild-type homozygote (CC), whereas the A allele exclusively depicted the mutant-type homozygote (AA). On the other hand, the heterozygote (CA) was characterized by the presence of both C and A alleles. The C or A allele was identified within the 486-bp product size in Fig. 3.

Fig. 3
figure 3

The PCR-AS product investigation of IL-18-rs1946518C/A was performed using 2% agarose gel electrophoresis. The analysis was carried out at 75 V and 20 mA for 60 min. A marker (2000-100 bp) was used as a reference. The (CC) wild-type homozygotes were shown to have only the C allele, while the (AA) mutant-type homozygotes had only the A allele. The (CA) heterozygotes showed both the C and A alleles. The presence of either the C or A allele was observed at a product size 486 bp

Full size image

To ensure the accuracy of the results, we randomly selected eight samples for sequencing, which included five samples from patients with IBD and three samples from healthy individuals. The findings, presented in Fig. 4, showed that two samples of healthy individuals with the CC genotype were homozygous for the wild-type allele of the rs1946518 SNP, with two copies of the IL-18 gene containing the C base at the SNP position, and one sample with the AA genotype was homozygous for the mutant-type allele of the rs1946518 SNP, with two copies of the IL-18 gene containing the A base at the SNP position. On the other hand, three IBD samples were homozygous for the mutant allele of the rs1946518 SNP, with both copies of the IL-18 gene containing the A base at the SNP position, while one IBD sample had the AA genotype, indicating that it was homozygous for the wild-type allele of the rs1946518 C/A SNP, while one IBD sample had the C/A genotype, indicating that they were heterozygous for the rs1946518 C/A SNP, with one copy of the IL-18 gene containing the C base at the SNP location and the other containing the A base. These results strongly suggest that the rs1946518 C/A SNP plays a role in milder forms of IBD, and other genetic factors may also contribute to IBD.

Fig. 4
figure 4

Sequence analysis of the IL-18 rs1946518 gene polymorphism was performed, including wild-type CC homozygotes containing two copies of the C allele, mutant AA homozygotes containing two copies of the A allele, and CA heterozygotes containing one copy of the C allele and a copy of the A allele, on eight randomly selected samples. The reference allele C is blue, while the mutant allele A is green

Full size image

The HWE was used to analyze the distribution of genotypes for the IL-18 rs1946518 gene in the control group. As shown in Table 6, out of the 46 control subjects, 31 had the homozygous wild genotype CC, 11 had the heterozygous CA genotype, and 4 had the homozygous mutant AA genotype. These results indicate no significant deviation from the expected distribution (P = 0.186) among the control subjects concerning their IL-18 rs1946518 genotypes.

Table 6 HWE for the healthy control group
Full size table

Genotypic and allelic analysis for IL-18 (rs1946518) in Crohn’s disease patients and healthy control

The comparison of genotypes and the frequency of alleles of the IL-18 rs1946518 between healthy controls and CD patients is presented in Table 7. There were no significant distinctions in the frequency analysis of genotypes among patients with CD and those without any disease (healthy control) (P = 0.171). The risk assessment results revealed that the presence of the heterozygous CA and the homozygous AA genotypes, with odds ratios of 1.12 and 3.87, respectively, showed no significant association with disease risk. According to these odds ratios, individuals with the homozygous AA genotype are estimated to have a three-fold higher risk of developing the disease than those with other genotypes.

Table 7 IL-18 (rs1946518) genotype and allele frequency in Patients with CD and healthy control
Full size table

Genotypic and allelic analysis for IL-18 (rs1946518) in ulcerative colitis patients and healthy control

The comparison of genotypes and allele frequencies of the IL-18 rs1946518 between healthy controls and UC patients is shown in Table 8. The findings demonstrated a significant difference in genotypes (p = 0.028) and allele frequency (p = 0.002) between the two groups. The risk assessment results revealed that the presence of the heterozygous CA and the homozygous AA genotypes, with odds ratios of 1.41 and 5.32, respectively, is significantly associated with disease risk. According to these odds ratios, individuals with the homozygous AA genotype are estimated to have a five-fold higher risk of developing the disease than those with other genotypes.

Table 8 IL-18 (rs1946518) genotype and allele frequency in Patients with UC and healthy control
Full size table

Discussion

Inflammatory bowel disease (IBD) is a group of conditions characterized by prolonged inflammation of the tissues in the digestive tract. Two primary types of IBD are CD and UC [21]. The IL-18 gene is located on chromosome 11 in humans and chromosome 9 in mice. It consists of 7 exons and contains two distinct promoters on exons 1 and 2. These promoters contain specific elements, including an interferon consensus sequence-binding protein and a PU.1 binding site [22]. IL-18 is a cytokine that regulates immune responses, particularly those in the intestines. It shares structural similarities with IL-1β and stimulates the production of interferon-gamma (IFN-γ), resulting in a Th1 response [23, 24]. Furthermore, IL-18 acts as a pro-inflammatory mediator that can worsen conditions such as IBD by contributing to increased intestinal permeability and inflammation [25]. The results obtained from this study in Table 4 show a high level of consistency with those previously reported by Ben Aleya et al. [26]. In their study, there was a conspicuous absence of significant differences (P = 0.189) between IL-18 rs187238 and susceptibility to CD. However, there was no agreement with our results regarding C allele frequency, as they demonstrate no significant distinctness in the Tunisian population. Furthermore, the findings align with Glas et al. [27], which showed that the IL-18 (-137 G/C) polymorphism was not associated with CD in a sample of white individuals descended from Germany. Despite this, the investigation revealed significant variations across several genotypes, alleles, and diplotypes in the IL-18 gene in CD based on CARD15/NOD2 status. Moreover, this argument is consistent with those of Aizawa et al. [28], which showed no significant differences in IL-18 (-137 G/C) SNP and CD progression in the Japanese populations. This investigation, however, confirmed that the TACGT haplotype pattern is associated with IBD, particularly CD, and single nucleotide polymorphisms at the 5’ end of the IL-18 gene are strongly associated with the risk of developing IBD.

These findings contrast with the meta-analysis conducted by Gao et al. [29], who reported that the IL-18 rs187238 G > C polymorphism may be associated with an increased risk of CD under five genetic models (all P < 0.05), especially among Asian and African patients. The results of these studies show inconsistency, which indicates that the importance of a gene may vary depending on the population and IBD type. The inconsistency in the results could be attributed to the diverse geographic distribution of the genetic mutation. Overall, our findings are also to those reported by Haas et al. [30], who found that the -137 (G/C) promoter polymorphism of IL-18 is not a decisive risk factor for CD in a German cohort. Similarly, Takagawa et al. [31] found no correlation between the IL-18-137 (G/C) variant and the susceptibility to CD in the Japanese population.

Our investigation into the Iraqi population in Table 5 revealed a difference in findings compared to a previous study by Ben Aleya et al. [26]. The study showed statistically significant differences (P = 0.038) between the IL-18 (-137G/C) gene and the tendency to develop UC in the Tunisian population. These contrasting results suggest that various confounding factors may contribute to the observed differences. Therefore, future studies must delve deeper into the underlying causes of these disparities and determine the true nature of the association between IL-18-137G/C and susceptibility to UC in diverse populations. Furthermore, the present findings strongly support the results reported by Glas et al. [27] regarding the lack of significant differences between the IL-18 (-137 G/C) polymorphism and UC in white people of German descent. These findings prove that this particular genetic variation does not substantially influence the progression of UC within this particular demographic. Additionally, these findings align with the study by Aizawa et al. [28] on the Japanese population, which showed no association between IL-18-137G/C and the pathogenesis of UC. Similarly, our results support the study conducted by Haas et al. [30], which indicated that this SNP is not a risk factor for UC in the German community. Additionally, Takagawa et al. [31] discovered no correlation between the IL-18-137G/C variant and susceptibility to UC in the Japanese population.

The IL-18-137 G/C polymorphism has been linked to a variety of diseases. It is correlated with an increased risk of head and neck cancer (HNC) and nasopharyngeal cancer in Asian populations [32]. Additionally, the C allele carrier of this polymorphism has been linked to a decreased risk of Alzheimer’s disease (AD) in Asians [33]. Moreover, the presence of IL-18-137 G/C has been correlated with a heightened susceptibility to type 1 diabetes (T1DM) within the population of Egypt. [34, 35]. Additionally, GC and CC genotypes of IL-18-137 G/C may increase the risk of childhood acute lymphocytic leukemia in the Taiwanese population [16]. Finally, this polymorphism has been significantly higher in bladder cancer patients than in healthy controls [36].

The results acquired from our thorough investigation in Table 7 demonstrate a lack of consistency compared to the previously documented findings by Aizawa et al. [28]. Their research indicated a complete absence of correlation between the IL-18 (-607 CA) gene and the occurrence of CD within the Japanese population. This disparity in outcomes suggests the need for further analysis and examination to fully understand the intricate relationship between IL-18 (-607CA) and the incidence of CD in different ethnic groups. Additionally, the present findings strongly support the results of Ben Aleya et al. [26], which showed no statistically significant differences between IL-18-607C/A and susceptibility to CD in the Tunisian population. Moreover, the present findings strongly support the outcomes stated by Glas et al. [27] regarding the lack of significant differences among the IL-18-607C/A SNP and patients with CD positive for mutations in the CARD15/NOD2 gene in white people of German descent. Furthermore, Takagawa et al. [31] discovered no correlation between the IL-18-607C/A SNP and susceptibility to CD in the Japanese population.

The results of our study in Table 8 contrast with those reported by Aizawa et al. [28], which found no relationship between IL-18 (-607 CA) and UC incidence in Japanese individuals. However, the present findings strongly support the results of Ben Aleya et al. [26], which showed statistically significant differences between IL-18-607C/A and susceptibility to UC in the Tunisian population. Moreover, Takagawa et al. [31] discovered no correlation between the IL-18-607C/A SNP and susceptibility to UC. However, we agreed with our results regarding A allele frequency, as they showed significant differences in the Japanese population. Overall, IL-18 (-607 AC) polymorphism seems to be associated with other diseases, but the exact nature of the association may vary depending on the disease. For example, a meta-analysis showed that the IL-18-607C/A polymorphism is associated with a decreased risk of prostate cancer in the Asian population but an increased risk in the Caucasian population [37]. Finally, the IL-18-607 AA genotype and A allele were associated with an increased risk of ischemic stroke in the Egyptian population [38]. The overall findings from these studies exhibit inconsistencies, indicating that the importance of this particular gene may vary depending on the population and type of inflammatory bowel disease being studied. The contrasting results can be attributed to the diverse geographical distribution of the genetic mutation.

Conclusion

The study concluded that there were no statistically significant differences between IL-18 rs187238G/C genotypes and the development of CD or UC. However, there was a significant difference in the frequency of the C allele for susceptibility to CD, while no association with susceptibility to UC was observed. The IL-18 rs1946518C/A variants’ genotypes and allelic frequency revealed a significant association with the likelihood of developing UC. However, there was no significant relationship between it and the probability of having CD patients in Babylon Governorate, Iraq.

Availability of data and materials

Not applicable.

Abbreviations

A:

Adenine

CD:

Crohn’s disease

C:

Cytosine

G:

Guanine

IBD:

Inflammatory bowel disease

IL:

Interleukin

PCR-AS:

Polymerase chain reaction-allele specific

PCR-RFLP:

Polymerase chain reaction-restriction fragment length polymorphism

SNPs:

Single nucleotide polymorphisms

T:

Thymine

UC:

Ulcerative colitis

s:

Second

V:

Volt

mA:

Milliampere

References

  1. Gerberi DJ (2018) Inflammatory bowel disease: a webliography. J Consum Health Internet 22(4):352–361

    Article  Google Scholar 

  2. Fakhoury M, Negrulj R, Mooranian A, Al-Salami H (2014) Inflammatory bowel disease: clinical aspects and treatments. J Inflamm Res 23:113–120

    Article  Google Scholar 

  3. Graham DB, Xavier RJ (2020) Pathway paradigms revealed from the genetics of inflammatory bowel disease. Nature 578(7796):527–539

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Windsor JW, Kaplan GG (2019) Evolving epidemiology of IBD. Curr Gastroenterol Rep 21:1–9

    Article  Google Scholar 

  5. Jarmakiewicz-Czaja S, Zielińska M, Sokal A, Filip R (2022) Genetic and epigenetic etiology of inflammatory bowel disease: an update. Genes 13(12):2388

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. M’Koma AE (2018) The multifactorial etiopathogeneses interplay of inflammatory bowel disease: an overview. Gastrointest Disord 1(1):75–105

    Article  Google Scholar 

  7. De Lange KM, Moutsianas L, Lee JC, Lamb CA, Luo Y, Kennedy NA, Jostins L, Rice DL, Gutierrez-Achury J, Ji SG, Heap G (2017) Genome-wide association study implicates immune activation of multiple integrin genes in inflammatory bowel disease. Nat Genet 49(2):256–261

    Article  PubMed  PubMed Central  Google Scholar 

  8. Huang H, Fang M, Jostins L, Umićević Mirkov M, Boucher G, Anderson CA, Andersen V, Cleynen I, Cortes A, Crins F, D’Amato M (2017) Fine-mapping inflammatory bowel disease loci to single-variant resolution. Nature 547(7662):173–178

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Cleynen I, Boucher G, Jostins L, Schumm LP, Zeissig S, Ahmad T, Andersen V, Andrews JM, Annese V, Brand S, Brant SR (2016) Inherited determinants of Crohn’s disease and ulcerative colitis phenotypes: a genetic association study. Lancet 387(10014):156–167

    Article  PubMed  PubMed Central  Google Scholar 

  10. Yurtcu E, Gokcan H, Yilmaz U, Sahin FI (2009) Detection of MEFV gene mutations in patients with inflammatory bowel disease. Genet Test Mol Biomarkers 13(1):87–90

    Article  CAS  PubMed  Google Scholar 

  11. Liu W, Wang C, Tang L, Yang H (2021) Associations between gene polymorphisms in pro-inflammatory cytokines and the risk of inflammatory bowel disease: a meta-analysis. Immunol Invest 50(8):869–883

    Article  CAS  PubMed  Google Scholar 

  12. Guan Q, Zhang J (2017) Recent advances: the imbalance of cytokines in the pathogenesis of inflammatory bowel disease. Mediators Inflamm 2017(1):4810258

    PubMed  PubMed Central  Google Scholar 

  13. De Souza HS, Fiocchi C (2016) Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol 13(1):13–27

    Article  PubMed  Google Scholar 

  14. Bamias G, Cominelli F (2016) Cytokines and intestinal inflammation. Curr Opin Gastroenterol 32(6):437–442

    Article  CAS  PubMed  Google Scholar 

  15. Kruse S, Kuehr J, Moseler M, Kopp MV, Kurz T, Deichmann KA, Foster PS, Mattes J (2003) Polymorphisms in the IL 18 gene are associated with specific sensitization to common allergens and allergic rhinitis. J Allerg Clin Immunol 111(1):117–122

    Article  CAS  Google Scholar 

  16. Giedraitis V, He B, Huang WX, Hillert J (2001) Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation. J Neuroimmunol 112(1–2):146–152

    Article  CAS  PubMed  Google Scholar 

  17. Chen CC, Tzeng HE, Kuo CC, Lim SN, Hsu PC, Hsu YN, Chin YT, Chang WS, Wang CH, Tsai CW, Pei JS (2022) Significant contribution of interleukin-18 genotypes to childhood acute lymphocytic leukemia risk in Taiwanese. Anticancer Res 42(11):5283–5290

    Article  CAS  PubMed  Google Scholar 

  18. Ihim SA, Abubakar SD, Zian Z, Sasaki T, Saffarioun M, Maleknia S, Azizi G (2022) Interleukin-18 cytokine in immunity, inflammation, and autoimmunity: biological role in induction, regulation, and treatment. Front Immunol 11(13):919973

    Article  Google Scholar 

  19. Su Y, Zhao H (2020) Predisposition of inflammatory bowel disease is influenced by IL-8, IL-10, and IL-18 polymorphisms: a meta-analysis. Int Arch Allergy Immunol 181(10):799–806

    Article  CAS  PubMed  Google Scholar 

  20. Bao J, Lu Y, Deng Y, Rong C, Liu Y, Huang X, Song L, Li S, Qin X (2015) Association between IL-18 polymorphisms, serum levels, and HBV-related hepatocellular carcinoma in a Chinese population: a retrospective case–control study. Cancer Cell Int 15:1–8

    Article  Google Scholar 

  21. McDowell C, Farooq U, Haseeb M (2023) Inflammatory bowel disease. StatPearls Publishing, Treasure Island

    Google Scholar 

  22. Nakanishi K, Yoshimoto T, Tsutsui H, Okamura H (2001) Interleukin-18 regulates both Th1 and Th2 responses. Annu Rev Immunol 19(1):423–474

    Article  CAS  PubMed  Google Scholar 

  23. Vecchie A, Bonaventura A, Toldo S, Dagna L, Dinarello CA, Abbate A (2021) IL-18 and infections: Is there a role for targeted therapies? J Cell Physiol 236(3):1638–1657

    Article  CAS  PubMed  Google Scholar 

  24. Hirooka Y, Nozaki Y (2021) Interleukin-18 in inflammatory kidney disease. Front Med 1(8):639103

    Article  Google Scholar 

  25. Williams MA, O’Callaghan A, Corr SC (2019) IL-33 and IL-18 in inflammatory bowel disease etiology and microbial interactions. Front Immunol 14(10):451192

    Google Scholar 

  26. Ben Aleya W, Sfar I, Habibi I, Mouelhi L, Aouadi H, Makhlouf M, Ayed-Jendoubi S, Najjar T, Abdallah TB, Ayed K, Gorgi Y (2011) Interleukin-18 gene polymorphisms in tunisian patients with inflammatory bowel disease. Digestion 83(4):269–274

    Article  CAS  PubMed  Google Scholar 

  27. Glas J, Török HP, Tonenchi L, Kapser J, Schiemann U, Müller-Myhsok B, Folwaczny M, Folwaczny C (2005) Association of polymorphisms in the interleukin-18 gene in patients with Crohn’s disease depending on the CARD15/NOD2 genotype. Inflamm Bowel Dis 11(12):1031–1037

    Article  PubMed  Google Scholar 

  28. Aizawa Y, Sutoh S, Matsuoka M, Negishi M, Torii A, Miyakawa Y, Sugisaka H, Nakamura M, Toda G (2005) Association of interleukin-18 gene single-nucleotide polymorphisms with susceptibility to inflammatory bowel disease. Tissue Antigens 65(1):88–92

    Article  CAS  PubMed  Google Scholar 

  29. Gao SJ, Zhang L, Lu W, Wang L, Chen L, Zhu Z, Zhu HH (2015) Interleukin-18 genetic polymorphisms contribute differentially to the susceptibility to Crohn’s disease. World J Gastroenterol: WJG 21(28):8711

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Haas SL, Andreas Koch W, Schreiber S, Reinhard I, Koyama N, Singer MV, Böcker U (2005) − 137 (G/C) IL-18 promoter polymorphism in patients with inflammatory bowel disease. Scand J Gastroenterol 40(12):1438–1443

    Article  PubMed  Google Scholar 

  31. Takagawa T, Tamura K, Takeda N, Tomita T, Ohda Y, Fukunaga K, Hida N, Ohnishi K, Hori K, Kosaka T, Fukuda Y (2005) Association between IL-18 gene promoter polymorphisms and inflammatory bowel disease in a Japanese population. Inflamm Bowel Dis 11(12):1038–1043

    Article  CAS  PubMed  Google Scholar 

  32. Wang Z, Gao ZM, Huang HB, Sun LS, Sun AQ, Li K (2018) Association of IL-8 gene promoter− 251 A/T and IL-18 gene promoter− 137 G/C polymorphisms with head and neck cancer risk: a comprehensive meta-analysis. Cancer Manag Res 10:2589–2604

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Zhang J, Song T, Liang H, Lian J, Zhang G, Gong H (2016) Interleukin-18− 137 G/C and− 607 C/A polymorphisms and Alzheimer’s disease risk: a meta-analysis. Neurol Sci 37:921–927

    Article  PubMed  Google Scholar 

  34. Ali YB, El-Gahel HE, Abdel-Hakem NE, Gadalla ME, El-Hefnawy MH, El-Shahat M (2021) Association between IL-18 and IL-6 gene polymorphisms and the risk of T1D in Egyptian children. J Diabetes Metab Disord 20:439–446

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Al-Shehmany AS, El-Kafoury AA, Haroun MA, Embaby AM. (2014) Genetic association between interleukin IL-18-137G/C and IL-18-607 C/A polymorphisms and type 1 diabetes in Egyptian population. Iraqi J Biotechnol. 13(2)

  36. Alkanli N, Ay A, Cevik G (2021) Investigation of the roles of IL-18 (-607 C/A) and IL-18 (-137 G/C) gene variations in bladder cancer development: case–control study. J Cancer Res Clin Oncol 147:3627–3637

    Article  CAS  PubMed  Google Scholar 

  37. Yuanyuan G, Xue Y, Yachao L, Xiao F, Xu C (2019) Association between IL-18 -607 C/A polymorphism and the risk of prostate cancer: a meta-analysis of case-control studies. Asian Pac J Cancer Prev 20(6):1595–1602. https://doi.org/10.31557/APJCP.2019.20.6.1595

    Article  PubMed  PubMed Central  Google Scholar 

  38. Bakr NM, Hashim NA, Awad A, Sarhan AA (2018) Association between Interleukin-18 promoter polymorphisms and risk of ischemic stroke: A case-control study. Egypt J Med Hum Genet 19(1):13–18

    Article  Google Scholar 

Download references

Acknowledgements

We extend our gratitude to the prestigious Digestive Diseases and Surgery Center at Marjan Medical City for supplying the necessary samples. We are also deeply appreciative of the patients and healthy volunteers who donated their samples, as their contributions were crucial to our research. Additionally, we thank Prof. Raad Kareem Abd-Aun from the Department of English, College of Education for Human Sciences, University of Babylon, for his linguistic review of the manuscript.

Funding

There was no source of funding. The authors were responsible for funding the research.

Author information

Authors and Affiliations

  1. Department of Biotechnology, College of Science, University of Babylon, Hilla, Iraq

    Yahya Jaber Al-ardawy & Ali Hmood Al-Saadi

  2. College of Medicine, University of Kufa, Kufa, Iraq

    Mahmoud A. Alkindy

  3. Republic of Iraq, Ministry of Health, Baghdad, Iraq

    Ammar M. Al-Lsawi & Maksad A. Fadheel

Authors
  1. Yahya Jaber Al-ardawy
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Ali Hmood Al-Saadi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mahmoud A. Alkindy
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Ammar M. Al-Lsawi
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Maksad A. Fadheel
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Yahya Jaber Al-ardawy (CA), Ali Hmood Al-Saadi, Mahmoud A. Alkindy, Ammar M. Al-Lsawi, and Maksad A. Fadheel: conceiving and designing the work, drafting the manuscript, critically revising the manuscript for important intellectual content, giving the final approval of the version submitted for publication, and being fully accountable for all aspects of the work to ensure that any questions regarding the accuracy or integrity of any part of the work are thoroughly investigated and resolved appropriately. It is worth noting that all authors have thoroughly read and approved the final manuscript.

Corresponding author

Correspondence to Yahya Jaber Al-ardawy.

Ethics declarations

Ethics approval and consent to participate

The study was conducted in accordance with the ethical principles derived from the Declaration of Helsinki. The verbal and analytical consent of the patients was obtained. The study protocol, subject information, and consent form were reviewed and approved by a local ethics committee under Project No. B230201 on July 2, 2022, to obtain the necessary approval.

Consent for publication

Consent to Publish in the Egyptian Journal of Medical Human Genetics.

Competing interests

The authors declare that they have no conflict of interest.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Al-ardawy, Y.J., Al-Saadi, A.H., Alkindy, M.A. et al. Study of the relationship between genetic variants of IL-18 and the occurrence of inflammatory bowel disease. Egypt J Med Hum Genet 25, 81 (2024). https://doi.org/10.1186/s43042-024-00555-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43042-024-00555-w

Keywords