- Research
- Open Access
- Published:
Detection of tmprss2-erg and tmprss2-egr1 gene fusion in prostate cancer from a Chinese population
Egyptian Journal of Medical Human Genetics volume 21, Article number: 53 (2020)
Abstract
Background
TMPRSS2: ETS gene fusion occurs recurrently in a high proportion of prostate cancer (PCa) patients in Western countries. However, for Chinese PCa patients, no solid conclusion could be drawn from the present studies, as the results varied considerably between the limited reports.
Results
In this study, we evaluated the prevalence of such gene rearrangements in a small number of Chinese PCa patients and discovered that 6 out of 27 (22.2%) were found to harbor the TMPRSS2: ERG fusion, the ratio was much lower than that in Western countries. Furthermore, we first identified TMPRSS2: EGR1 gene fusion, suggesting other chromosome rearrangements besides ETS gene family harbor in prostate cancer. The hybrid transcript was predicted to encode a truncated EGR1 protein by ORF finder, which might play a key role in prostate cancer.
Conclusions
We reported that the total occurrence rate of TMPRSS2: ERG fusion gene in this small group of Chinese patients was lower than the reported frequencies in European descent patients but comparable to other reported frequencies in Asian populations. The occurrence of TMPRSS2: EGR1 gene fusion suggested other chromosome rearrangements in prostate cancer.
Background
Prostate cancer (PCa) is the second most common male malignancy and the fifth leading cause of cancer death among men worldwide [1]. Although the incidence of PCa is relatively low in China, it has been increased dramatically since the 1980s [2, 3]. Extensive studies have been conducted to understand the genetic mechanism underlying PCa initiation and progression [4, 5]. In 2005, using a systems biology approach, Tomlins et al. first reported that the androgen response gene transmembrane protease, serine 2 (TMPRSS2) was fused to E-Twenty-Six (ETS) family genes ERG (v-ETS avian erythroblastosis virus E26 oncogene homolog) and ETV1 (ETS variant 1) in some PCa patients [6]. Subsequent studies have shown that such gene fusion occurs at a relatively high frequency, e.g., up to 65% of clinically localized prostate cancers showed TMPRSS2 rearrangement in European descent PCa patients [7]. Besides, a diversity of TMPRSS2: ETS fusion transcripts have been discovered. For example, Clark et al. showed that an extensive array of differently sized bands could be detected using reverse transcriptase–PCR (RT-PCR)-based approach [8], and Jhavar et al. reported that 15 of 27 prostate cancer samples were found to have altered transcription of the ERG gene [9]. Among the various types of fusion genes, the TMPRSS2: ERG fusion is the most common [10].
It is well known that PCa exhibits racial/ethnic disparities in both incidence and survival among races and countries [11, 12]. Therefore, the incidence of such gene fusions has been examined in other populations. For instance, Miyagi et al. reported a fusion rate of 28% (54/194) for the TMPRSS2: ERG gene in Japanese PCa patients [13], while Lee et al. found a fusion rate of 20.9% (53/254) in a Korean cohort [14]. Using tissue microarrays, Saramaki et al. demonstrated that 37% of hormone-refractory PCa carried the TMPRSS2: ERG rearrangement [15]. Although there is variation among these numbers, a comparison between the values found in Asian populations and the reported 40–60% prevalence in Western countries suggests that this gene fusion is lower in Asian than in Western countries. Also, it has been shown that TMPRSS2: ERG gene fusion prevalence and class are significantly different among European descent, African-American, and Japanese PCa patients [16]. In China, several groups have also undertaken an effort to evaluate the occurrence of such gene fusions in Chinese PCa patients. Similar to the findings from the Japanese and Korean PCa studies, Mao et al. found a low frequency of TMPRSS2: ERG fusions in a Chinese cohort using a genome-wide approach [17]. Using an RNA-seq method, Ren et al. identified 3 of the 14 tumors (21.4%) as harboring a TMPRSS2: ERG fusion in Chinese patients [18]. However, Wang et al. reported that 46 out of 100 PCa patients had the TMPRSS2: ERG fusion product in Northern China, a ratio similar to that seen in the European descent population [19]. Thus, these variable results warrant further examination regarding the prevalence of such gene fusions in Chinese PCa patients.
In this study, we used nested RT-PCR to screen for the presence of TMPRSS2: ERG fusions in a small group (a total of 27) of Chinese PCa patients. We found that 6 out of the 27 biopsy samples harbored the TMPRSS2: ERG fusion and 1 sample contained a novel TMPRSS2: EGR1 fusion.
Methods
Patient data and prostate needle biopsy
Transrectal ultrasounds (TRUS)-biopsies of the prostate were prospectively collected at the First Affiliated Hospital, Zhejiang University School of Medicine. In short, two-needle biopsies were taken simultaneously from the same prostate region of each patient. One was used for diagnosis by pathology, while the other was snap-frozen in liquid nitrogen and stored at – 80 °C for fusion gene detection. In all, a total of 27 PCa and 5 BPH specimens were used in the present study; the clinical pathology data are shown in Table 1.
RNA isolation and nested RT-PCR
Total RNA was extracted from frozen biopsies using Trizol (Reagent Cat. No. 15596-026, Invitrogen, Carlsbad, CA, USA). One to 5 μg total RNA was reverse-transcribed to cDNA with random hexamers using the Superscript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). The nested primers used for TMPRSS2: ERG and TMPRSS2: ETV1 fusion gene detection were previously described by Soller et al. [20], namely, TMPRSS2-1F: 5′-CGC GAG CTA AGC AGG AGG CG-3′; TMPRSS2-20F: 5′-GGA GGC GGA GGC GGA GGG-3′; ERG-541R: 5′-TCA TGT TTG GGG GTG GCA TGT G-3′; ERG-450R: 5′-TTG GCC ACA CTG CAT TCA TCA GGA-3′; ETV1-580R: 5′-GAT GGA GGG AGG TGA GCT GGG AA-3′; and ETV1-502R 5′-GAC ACT GGC GTG CTG GAT GGT GT-3′. Two microliters of synthesized cDNA was used for the first round of PCR, then 1 μl PCR product was subjected to nested PCR; both rounds were performed using high fidelity polymerase Primestar (Cat. No. R023A, Takara Bio Inc., Shiga, Japan). SYBR Green Real-time PCR Master Mix (Cat. No. QPK-201, Toyobo, Osaka, Japan) was used for PCR amplification with an annealing temperature of 65 °C. For standard reverse transcription-polymerase chain reaction (RT-PCR), 35 cycles were used. β-actin with the forward primer GATGAGATTGGCATGGCTTT and reverse primer CACCTTCAC CGTTCCAGTTT was used as a positive control.
T/A subcloning and DNA sequencing
Following nested PCR, “Adenine” was added to the 3′-end of PCR products by adding 1 μl 20 mM dATP and 2.5 U Taq polymerase (Cat. No. M0273S, NEB, Ipswich, MA, USA) to the reaction mixture at 72 °C for 10 min. Next, the PCR products were subjected to electrophoresis and then extracted from the gel, subcloned into the pMD-19T vector (Cat. No. 6031, Takara Bio Inc., Shiga, Japan), and sequenced using the ABI Prism 3730 DNA Analyzer (Applied Biosystems Inc.).
Results
A low frequency of TMPRSS2-ERG gene fusion was observed in Chinese PCa patients
To evaluate the frequency of TMPRSS2: ERG and TMPRSS2: ETV1 chimeric transcripts in Chinese PCa patients, nested PCR was performed to screen 32 biopsy samples, including 5 BPH and 27 PCa. Gel electrophoresis of the PCR products showed that 13 out of 27 cancer samples displayed amplified products, while no visual band was seen in BPH samples or the blank RT reaction control (Fig. 1a). Individual PCR products were extracted from the gels and subjected to T/A subcloning into a pMD-19T vector for DNA sequencing. However, sequencing results revealed that only 6 of the cancer biopsy samples contained the TMPRSS2: ERG fusion, while the others were all false positives (Table 1). The sequencing results also revealed that either exon 1 or 3 of TMPRSS2 (NM_005656.3) was fused to exon 5 of ERG (NM_004449.4) (Fig. 1b, c).
Detection of TMPRSS2: ERG hybrid transcripts in needle biopsy samples from Chinese PCa patients. a Representative gel electrophoresis results of TMPRSS2: ERG gene fusion as detected by nested-PCR. M, molecular markers; lane 1, negative control; lanes 2–15, PCa samples; lane 16, BPH sample. b The PCR products were extracted from the gel, then subcloned into the pMD19-T vector. The hybrid transcripts were identified by sequencing. c The schematic structure of the TMPRSS2 (NM_005656.3) and ERG (NM_004449.4) transcripts, as well as their hybrid mRNAs. The coding region is shown in deep color
Tmprss2-egr1 fusion in prostate cancer
A specific forward primer for TMPRSS2 and a reverse primer for EGR1 were used to identify the fusion transcript among TMPRSS2 and ERG1. As shown in Fig. 2a, the product in sample no.19 was the same size as the product from the constructed no.19 T-vector. The sequencing of the product also confirmed that the TMPRSS2 gene was indeed fused to EGR1 in sample no. 19 (Fig. 2b, c). Then, we analyze the whole fusion transcript by NCBI ORF finder to estimate its possibility of encoding protein. The initiation for translation was predicted to occur within exon 2 of EGR1(NM_001964.2), which can encode an N-terminal truncated protein but less 163 amino acid than normal EGR1. Interestingly, the predicted structures of the truncated protein retained both SPF1 and zf-C2H2 domain and the phosphorylation sites (Fig. 3a, b).
Expression of TMPRSS2: EGR1 fusion gene in needle biopsy samples of PCa patient no. 19. a Detection TMPRSS2: EGR1 gene fusion by nest PCR. M, molecular mark; lane 1, the TMPRSS2: EGR1 T/A clone vector; lane 2, no. 19 sample cDNA; lane 3, ddH2O as negative control. b TMPRSS2:EGR1 hybrid transcript was identified by sequencing. Position no. 268 of TMPRSS2 exon 4 was fused to position no. 721 of EGR1 exon 2. c The schematic structure of TMPRSS2(NM_005656.3), EGR1 (NM_001964.2), and their hybrid mRNAs. The coding region was shown in deep color
Structure of putative truncated protein coded by TMPRSS2-EGR1 hybrid transcript. a The coding sequence predicted by NCBI ORF Finder. The highest rank of the open reading frame is + 2 frame shown in green. b The schematic structure of TMPRSS2(NP_005647.3), EGR1 (NP_001955.1) protein, and the putative truncated protein coded by their hybrid mRNA. The predicted structure contains SPF1, zf-C2H2 domain, and all three phosphorylation sites
Discussion
TMPRSS2: ERG fusion is believed to play a critical role in detecting and managing prostate cancer. In tissue, TMPRSS2: ERG fusion markedly improved the improved PCa specificity compared with prostate-specific antigen (PSA) or derivatives or related kallikreins [21, 22]. The TMPRSS2: ERG fusion transcripts in urine samples were found to be one of the most advanced urine-based prostate cancer (PCa) early detection biomarkers. When combined with urinary marker PCa antigen 3 (PCA3), urinary TMPRSS2: ERG has been reported to provide high specificity and sensitivity in diagnosing PCa [23]. In the logistic regression models, termed Mi-Prostate Score (MiPS), the information from urinary TMPRSS2: ERG and PCA3 improved on serum prostate-specific antigen (or a multivariate risk calculator) for predicting the presence of PCa and high-grade PCa on biopsy [24]. Besides, there is evidence that the presence of the TMPRSS2: ERG fusion is a possible prognosticator of PCa outcome. In a cohort of localized PCa patients treated by watchful waiting, TMPRSS2: ERG fusion was reported in association with Gleason score and cancer-specific death [25]. In black South African men, the presence of TMPRSS2-ERG fusion was found to inversely associate with aggressive prostate cancer and low-grade disease in younger patients [26]. The presence of TMPRSS2: ERG fusion could increase cell migration and subcutaneous tumor size and promote bone metastases of prostate cancer by stimulating bone formation and inhibiting the osteolytic response [27, 28]. Given the importance of TMPRSS2-ERG fusion in the early detection and management of PCa, there is therefore an urgent need to identify the prevalence of this gene rearrangement in different populations.
Since the discovery of the TMPRSS2: ETS fusion gene in PCa in 2005, the prevalence of this gene rearrangement has been extensively investigated in different populations. As it is known that the incidence and mortality of PCa vary among different ethnic, racial, and national groups [29], the possibility existed that the occurrence of such gene fusions would differ among different populations. Accumulating evidence supports this difference, and it is now clear that European PCa patients have a higher (over 40%) fusion rate as compared to Asian patients (around 20%) [16]. However, for Chinese PCa patients, no solid conclusion could be drawn at present, as the observations varied greatly between the limited reports. Therefore, in our study, we first screened for this gene fusion in a small number of Chinese PCa patients. Our results showed that the total frequency of the TMPRSS2: ETS fusion gene was 25.9% (7 out of 27), while the frequency for the TMPRSS2: ERG fusion was 22.2% (6 in 27) in needle biopsy samples taken from Chinese PCa patients. Even though such a small number does not provide any significant statistical power, it still offers some basic information regarding the incidence of such gene fusion in Chinese PCa patients. These results are similar to those observed by Mao et al. [17] and Ren et al. [26], but are much lower than those reported by Wang et al. [18, 19]. It has been suggested that many factors could contribute to such differences, such as the samples selected, the patients’ age, preoperative PSA levels, tumor stage, Gleason scores, etc. [19]. Interestingly, Mao et al. used the single-nucleotide polymorphism (SNP) array analysis [17], Ren et al. used RNA-seq [18], while Wang et al. used fluorescent in situ hybridization (FISH) analysis [19]. As high-throughput technologies such as RNA-seq can provide information with much higher resolution, results obtained using such techniques may be more accurate. For example, when we only looked at the nested RT-PCR results (Fig. 1a), a fusion rate of 48.1% (13 out of 27) could be calculated. However, after subcloning and sequencing, only 6 cases were confirmed as true positives. Therefore, we believe that in Chinese PCa patients, the fusion rate should be around 20%, as reported in Japan and Korean cohorts. Still, a much larger and more detailed study of a Chinese PCa cohort is necessary to answer this question definitively
Egr1, the transcription factor early growth response 1, overexpressed in most aggressively prostate cancer but usually low in normal prostate tissue, encoded a 59 kDa protein while its phosphorylation showed 80 kDa by electrophoresis [30]. However, the role of Egr1 in tumor growth was still controversial. In prostate cancer, the high expression of Egr1closely link to the tumor development stage and Gleason score [31], while in human fibrosarcoma, Egr1 can inhibit the tumor transformation through induction of TGF-β1, fibronectin, and plasminogen activator inhibitor-1 [32], which was possibly due to the loss of function of P53 and PTEN in prostate cancer [33]. Here, we reported a new gene fusion in one case of prostate cancer, which involved in 5′ end of TMPRSS2 fusing to EGR1 but failed to detect the new gene fusion in other samples. We analyzed the whole fusion transcript by NCBI ORF and found the predicted structures of the truncated protein retained both SFP1 and zf-C2H2 domain and the phosphorylation sites. As zf-C2H2 is a zinc finger domain, a classical DNA binding domain [34]and SFP1 is a transcription factor [35], these domains in EGR1 further strengthened its function as a transcription factor. Although more sample needs to be screened to further verify the frequency of TMP-EGR1 gene fusion in prostate cancer, we infer it would be rare like other fusion gene ETV4 or ETV5 according to the present results [36, 37].
Conclusions
In conclusion, in the present study, we reported that the total occurrence rate of TMPRSS2: ERG fusion gene in this small group of Chinese patients was 22.2% (6/27), which is lower than the reported frequencies in European descent patients, but comparable to other reported frequencies in Asian populations.
Availability of data and materials
Not applicable.
Abbreviations
- PCa:
-
Prostate cancer
- TMPRSS2:
-
Transmembrane serine protease 2
- ERG:
-
ETS-related gene
- ETS:
-
E-Twenty-Six
- ETV1:
-
ETS variant 1
- RT-PCR:
-
Reverse transcriptase–PCR
References
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6):394–424. https://doi.org/10.3322/caac.21492
Kimura T, Egawa S (2018) Epidemiology of prostate cancer in Asian countries. Int J Urol 25(6):524–531. https://doi.org/10.1111/iju.13593
Baade PD, Youlden DR, Cramb SM, Dunn J, Gardiner RA (2013) Epidemiology of prostate cancer in the Asia-Pacific region. Prostate Int 1(2):47–58. https://doi.org/10.12954/PI.12014
Houlahan KE, Shiah YJ, Gusev A, Yuan J, Ahmed M, Shetty A et al (2019) Genome-wide germline correlates of the epigenetic landscape of prostate cancer. Nat Med 25(10):1615–1626. https://doi.org/10.1038/s41591-019-0579-z
Wang G, Zhao D, Spring DJ, DePinho RA (2018) Genetics and biology of prostate cancer. Genes Dev 32(17-18):1105–1140. https://doi.org/10.1101/gad.315739.118
Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW et al (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310(5748):644–648. https://doi.org/10.1126/science.1117679
Mehra R, Tomlins SA, Shen R, Nadeem O, Wang L, Wei JT et al (2007) Comprehensive assessment of TMPRSS2 and ETS family gene aberrations in clinically localized prostate cancer. Mod Pathol 20(5):538–544. https://doi.org/10.1038/modpathol.3800769
Clark J, Merson S, Jhavar S, Flohr P, Edwards S, Foster CS et al (2007) Diversity of TMPRSS2-ERG fusion transcripts in the human prostate. Oncogene 26(18):2667–2673. https://doi.org/10.1038/sj.onc.1210070
Jhavar S, Reid A, Clark J, Kote-Jarai Z, Christmas T, Thompson A et al (2008) Detection of TMPRSS2-ERG translocations in human prostate cancer by expression profiling using GeneChip Human Exon 1.0 ST arrays. J Mol Diagn 10(1):50–57. https://doi.org/10.2353/jmoldx.2008.070085
Falzarano SM, Magi-Galluzzi C (2013) ERG protein expression as a biomarker of prostate cancer. Biomark Med 7(6):851–865. https://doi.org/10.2217/bmm.13.105
Jalloh M, Myers F, Cowan JE, Carroll PR, Cooperberg MR (2015) Racial variation in prostate cancer upgrading and upstaging among men with low-risk clinical characteristics. Eur Urol 67(3):451–457. https://doi.org/10.1016/j.eururo.2014.03.026
Miller KD, Goding Sauer A, Ortiz AP, Fedewa SA, Pinheiro PS, Tortolero-Luna G et al (2018) Cancer Statistics for Hispanics/Latinos, 2018. CA Cancer J Clin 68(6):425–445. https://doi.org/10.3322/caac.21494
Miyagi Y, Sasaki T, Fujinami K, Sano J, Senga Y, Miura T et al (2010) ETS family-associated gene fusions in Japanese prostate cancer: analysis of 194 radical prostatectomy samples. Mod Pathol 23(11):1492–1498. https://doi.org/10.1038/modpathol.2010.149
Lee K, Chae JY, Kwak C, Ku JH, Moon KC (2010) TMPRSS2-ERG gene fusion and clinicopathologic characteristics of Korean prostate cancer patients. Urology 76(5):1268 e1267-1213. https://doi.org/10.1016/j.urology.2010.06.010
Saramaki OR, Harjula AE, Martikainen PM, Vessella RL, Tammela TL, Visakorpi T (2008) TMPRSS2:ERG fusion identifies a subgroup of prostate cancers with a favorable prognosis. Clin Cancer Res 14(11):3395–3400. https://doi.org/10.1158/1078-0432.CCR-07-2051
Magi-Galluzzi C, Tsusuki T, Elson P, Simmerman K, LaFargue C, Esgueva R et al (2011) TMPRSS2-ERG gene fusion prevalence and class are significantly different in prostate cancer of Caucasian, African-American and Japanese patients. Prostate 71(5):489–497. https://doi.org/10.1002/pros.21265
Mao X, Yu Y, Boyd LK, Ren G, Lin D, Chaplin T et al (2010) Distinct genomic alterations in prostate cancers in Chinese and Western populations suggest alternative pathways of prostate carcinogenesis. Cancer Res 70(13):5207–5212. https://doi.org/10.1158/0008-5472.CAN-09-4074
Ren S, Peng Z, Mao JH, Yu Y, Yin C, Gao X et al (2012) RNA-seq analysis of prostate cancer in the Chinese population identifies recurrent gene fusions, cancer-associated long noncoding RNAs and aberrant alternative splicings. Cell Res 22(5):806–821. https://doi.org/10.1038/cr.2012.30cr201230
Wang JJ, Liu YX, Wang W, Yan W, Zheng YP, Qiao LD et al (2012) Fusion between TMPRSS2 and ETS family members (ERG, ETV1, ETV4) in prostate cancers from northern China. Asian Pac J Cancer Prev 13(10):4935–4938
Soller MJ, Isaksson M, Elfving P, Soller W, Lundgren R, Panagopoulos I (2006) Confirmation of the high frequency of the TMPRSS2/ERG fusion gene in prostate cancer. Genes Chromosom Cancer 45(7):717–719. https://doi.org/10.1002/gcc.20329
Salagierski M, Schalken JA (2012) Molecular diagnosis of prostate cancer: PCA3 and TMPRSS2:ERG gene fusion. J Urol 187(3):795–801. https://doi.org/10.1016/j.juro.2011.10.133
Pettersson A, Graff RE, Bauer SR, Pitt MJ, Lis RT, Stack EC et al (2012) The TMPRSS2:ERG rearrangement, ERG expression, and prostate cancer outcomes: a cohort study and meta-analysis. Cancer Epidemiol Biomark Prev 21(9):1497–1509. https://doi.org/10.1158/1055-9965.EPI-12-0042
Sanguedolce F, Cormio A, Brunelli M, D'Amuri A, Carrieri G, Bufo P et al (2016) Urine TMPRSS2: ERG fusion transcript as a biomarker for prostate cancer: literature review. Clin Genitourin Cancer 14(2):117–121. https://doi.org/10.1016/j.clgc.2015.12.001
Tomlins SA, Day JR, Lonigro RJ, Hovelson DH, Siddiqui J, Kunju LP et al (2016) Urine TMPRSS2:ERG Plus PCA3 for individualized prostate cancer risk assessment. Eur Urol 70(1):45–53. https://doi.org/10.1016/j.eururo.2015.04.039
Demichelis F, Fall K, Perner S, Andren O, Schmidt F, Setlur SR et al (2007) TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort. Oncogene 26(31):4596–4599. https://doi.org/10.1038/sj.onc.1210237
Blackburn J, Vecchiarelli S, Heyer EE, Patrick SM, Lyons RJ, Jaratlerdsiri W et al (2019) TMPRSS2-ERG fusions linked to prostate cancer racial health disparities: A focus on Africa. Prostate 79(10):1191–1196. https://doi.org/10.1002/pros.23823
Delliaux C, Tian TV, Bouchet M, Fradet A, Vanpouille N, Flourens A et al (2018) TMPRSS2:ERG gene fusion expression regulates bone markers and enhances the osteoblastic phenotype of prostate cancer bone metastases. Cancer Lett 438:32–43. https://doi.org/10.1016/j.canlet.2018.08.027
Deplus R, Delliaux C, Marchand N, Flourens A, Vanpouille N, Leroy X et al (2017) TMPRSS2-ERG fusion promotes prostate cancer metastases in bone. Oncotarget 8(7):11827–11840. https://doi.org/10.18632/oncotarget.14399.
Iyengar S, Hall IJ, Sabatino SA (2020) Racial/ethnic disparities in prostate cancer incidence, distant stage diagnosis, and mortality by U.S. census region and age-group, 2012-2015. Cancer Epidemiol Biomark Prev. https://doi.org/10.1158/1055-9965.EPI-19-1344
Gabriel KN, Jones AC, Nguyen JP, Antillon KS, Janos SN, Overton HN et al (2016) Association and regulation of protein factors of field effect in prostate tissues. Int J Oncol 49(4):1541–1552. https://doi.org/10.3892/ijo.2016.3666
Li L, Ameri AH, Wang S, Jansson KH, Casey OM, Yang Q et al (2019) EGR1 regulates angiogenic and osteoclastogenic factors in prostate cancer and promotes metastasis. Oncogene 38(35):6241–6255. https://doi.org/10.1038/s41388-019-0873-8
Liu C, Yao J, de Belle I, Huang RP, Adamson E, Mercola D (1999) The transcription factor EGR-1 suppresses transformation of human fibrosarcoma HT1080 cells by coordinated induction of transforming growth factor-beta1, fibronectin, and plasminogen activator inhibitor-1. J Biol Chem 274(7):4400–4411
Baron V, Adamson ED, Calogero A, Ragona G, Mercola D (2006) The transcription factor Egr1 is a direct regulator of multiple tumor suppressors including TGFbeta1, PTEN, p53, and fibronectin. Cancer Gene Ther 13(2):115–124. https://doi.org/10.1038/sj.cgt.7700896
Hu Y, Sun L, Zhang Y, Lang J, Rao J (2020) Phosphoproteomics reveals key regulatory kinases and modulated pathways associated with ovarian cancer tumors. Onco Targets Ther 13:3595–3605. https://doi.org/10.2147/OTT.S240164
Matveenko AG, Drozdova PB, Belousov MV, Moskalenko SE, Bondarev SA, Barbitoff YA et al (2016) SFP1-mediated prion-dependent lethality is caused by increased Sup35 aggregation and alleviated by Sis1. Genes Cells 21(12):1290–1308. https://doi.org/10.1111/gtc.12444
Tomlins SA, Mehra R, Rhodes DR, Smith LR, Roulston D, Helgeson BE et al (2006) TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. Cancer Res 66(7):3396–3400. https://doi.org/10.1158/0008-5472.CAN-06-0168
Helgeson BE, Tomlins SA, Shah N, Laxman B, Cao Q, Prensner JR et al (2008) Characterization of TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusions in prostate cancer. Cancer Res 68(1):73–80. https://doi.org/10.1158/0008-5472.CAN-07-5352
Acknowledgements
The authors would like to thank all the patients who participant in this study.
Funding
This work was supported by in part by grants from the National Natural Science Foundation of China (nos. 81602795 and 31971138) and Natural Science Foundation of Zhejiang Province (nos. LQ15H260002, LY18H260002, LZ19H260001, and LY19H260002).
Author information
Affiliations
Contributions
XX and JY contributed to the design; CX, JL, MW, and YW contributed to the conduction of experiments, data collection and analyses, and discussion; ZC, YC, and YH contributed to the research design and reviewed the manuscript; JY was the guarantor of this work and, as such, had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the analysis. All authors have read and approved the manuscript.
Corresponding authors
Ethics declarations
Ethics approval and consent to participate
This study has been approved by the Zhejiang University School of Medicine Ethics Committee (no. 2018-326) and the patients have signed an informed written consent.
Consent for publication
Not applicable.
Competing interests
All authors declared that they have no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Xu, C., Luo, J., Wang, M. et al. Detection of tmprss2-erg and tmprss2-egr1 gene fusion in prostate cancer from a Chinese population. Egypt J Med Hum Genet 21, 53 (2020). https://doi.org/10.1186/s43042-020-00092-2
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s43042-020-00092-2
Keywords
- Fusion gene
- Prostate cancer
- ERG
- TMPRSS2