- Research
- Open access
- Published:
Flavanones from Sorghum bicolor selectively inhibit COX-2: in-silico and in-vivo validation
Egyptian Journal of Medical Human Genetics volume 20, Article number: 34 (2019)
Abstract
Background
COX-2-specific inhibitors offer improved advantages over traditional NSAIDs. Plants are known to play critical roles in the discovery and developments of new pharmaceuticals. To the best of our knowledge, nothing has been reported so far on the selective inhibition of the cyclooxygenase by flavanones. The present study aims at evaluating the selective inhibition of COX-1 and/or COX-2 by flavanones from Sorghum bicolor.
Results
Flavanones demonstrate selective inhibition of COX-2 through the formation of hydrogen bonds. Eriodictyol forms two hydrogen bonds interactions (Tyr-371 and Ser-516) within the active site of COX-2, while it forms only one hydrogen bond (Met-521) with COX-1. Sorghum bicolor flavanone extract (SBFE) demonstrate hepatoprotective potentials by augmenting the antioxidant defense system of the liver and downregulate the expression of COX-2 while ineffective against COX-1. Histopathological analyses show that SBFE is effective in the prevention of HCl/ethanol-induced gastric injury in Wistar rats.
Conclusions
The side effects associated with current NSAIDs are as a result of selective inhibition of COX-1. Flavanones are potential selective inhibitors of COX-2. Sorghum bicolor flavanone extract (SBFE) demonstrates its anti-inflammatory potential through selective inhibition of COX-2. The virtual high throughput screening techniques adopted herein could help eradicate the corresponding rigors of identifying lead bioactive(s) components of plants.
Graphical abstract
![](http://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs43042-019-0029-y/MediaObjects/43042_2019_29_Figa_HTML.png)
Background
Inflammation is a biological reaction to disruption in the normal physiological processes [1]. It is a localized protective reaction of the tissues of the body to allergic or chemical irritation, injury, and/or infections. Inflammation is characterized by pain redness, swelling, and loss of functions [2].
Acute inflammation leads to the release of leukocytes, erythrocytes, and constituents of the plasma into the surrounding tissues affected by the inflammatory insults. Chronic inflammation always results from acute inflammation, when the latter remains uncorrected. Chronic inflammation leads to the release of lymphocytes and macrophages into the affected tissue, and it is closely associated with allergies, atherosclerosis, cancer, arthritis, and Alzheimer’s disease, as well as autoimmune diseases [3]. Non-steroidal anti-inflammatory drugs (NSAIDs) bring about their therapeutic effects through the inhibition of the cyclooxygenases (COX), the enzymes that produce the prostaglandins (PGs) [4]. Cyclooxygenase-1 (COX-1) is constitutive; its PGs protect the stomach and the kidney from damage, while cyclooxygenase-2 (COX-2) is induced by inflammatory stimuli; its PGs contribute to the pain and swelling associated with inflammation.
The anti-inflammatory effects of NSAIDs are due to the inhibition of COX-1 and COX-2. The unwanted side effects (irritation of the stomach lining and toxicity on the kidney) are as a result of the inhibition of COX-1 [4].
Chronic inflammation is often related to alcohol consumption [5]. Alcohol mediates activation of pro-inflammatory and anti-inflammatory genes in the liver [5]. Administration of hydrochloric acid (HCl) and ethanol produces ulcerative lesions and increases lipid peroxidation in the gastric mucosa, which plays a significant part in the pathogenesis of the mucosal lesion [6].
Herbal and natural products are known for their biological and pharmacological activities [6]. Several drug candidates have been identified from plants, due to their reduced offensive factors, effectiveness in the treatment of certain ailments, better patient tolerance, and relatively affordable [7]. Medicinal plants have been reported to possess anti-inflammatory properties [8].
Virtual screening is an in-silico high throughput technique of screening compounds against biological target(s) and evaluation of the scoring. This technique gives a swift evaluation of vast libraries and prune down the number of compounds in order to pinpoint the hit compound(s) [9]. Molecular docking remains the most used virtual screening technique [10] and has turn out to be increasingly efficacious [11, 12].
In the present study, a total of 800 phytochemicals characterized from 17 medicinal plants [13,14,15,16,17,18,19,20,21,22,23]; Allium sativum, Aloe vera, Curcuma longa, Cymbopogon citratus, Dracaena arborea, Hibiscus sabdariffa, Moringa oleifera, Nicotiana tabacum, Ocimum gratissimum, Psidium guajava, Telfairia occidentalis, Vernonia amygdalina, Ziginber officinale, Amaranthus spinosus, Phoenix dactylefera, Plukenetia conophorum, and Sorghum bicolor were screened against the catalytic sites of COX-1 and COX-2. Sorghum bicolor is used in traditional medicine, for the primary care of anemia [24, 25] and in the treatment of various infectious diseases.
Methods
Data collection and preparation
A library of 800 characterized phytochemicals from 17 reported medicinal plants were created [13,14,15,16,17,18,19,20,21,22,23]. The phytochemicals were obtained from literature and downloaded in the Structure data format (Sdf format) from the PubChem database (https://pubchem.ncbi.nlm.nih.gov). Open babel was used to convert phytochemicals from their sdf formats to the protein data bank (pdb) formats. The ligprep command line was used to convert phytochemicals from the pdb formats to the protein data bank charged format (pdqt formats). The structure of COX-2 in complex with a benzopyran, (2R)-6,8-dichloro-7-(2-methylpropoxy)-2-(trifluoromethyl)-2H-chromene-3-carboxylic acid (3NTG with a crystallographic resolution of 2.19 A° was adopted for virtual screening and docking because of its high resolution and a few numbers of co-crystallized compounds when compared with several other COX-2 protein in the PDB) [26] was downloaded from the protein data bank (http://www.rcsb.org). PyMOL plugin in Autodock/Vina was used to extract the receptor. The SWISS-PdbViewer software was used to rebuild missing residues and atoms of the human COX-2 [27]. The experimental animals were randomized based on their body weight and allocated into six groups of five rats each.
Structural modeling of human COX-1 and validation
The human amino acids fasta sequences of COX-1 with accession number AAH29840.1 was obtained from the PubMed repository; this was used to carry out the homology model of COX-1 using the Swiss model server (swissmodel.expasy.org). The model was built on 2OYE [28] template with an identity of 92.8 and X-ray crystallography resolution of 2.8 Å and grid coordinates set as obtained in the co-crystallized compound, x = 251.28, y = 108.48, z = − 39.57. The modeled protein structure was validated using the Procheck server (http://servicesn.mbi.ucla.edu/PROCHECK) [29]. The active site of the modeled protein was predicted with CASTP (sts.bioe.ulc.edu).
Molecular docking and virtual high throughput screening
Virtual high throughput screening (vHTS), a computational technique used to screen a pool of compounds library against the target receptor, was used to screen phytochemicals against the binding pocket of COX-2 [23]. The grid coordinates were set exactly like those of the co-crystallized compound, x = 26.73, y = 21.49, z = 17.16.
Validation of docking results
The co-crystallized ligand was re-docked into the catalytic site of COX-2 to validate the accuracy of the docking protocols [30, 31]. Root means square deviation (RMSD), a measure of the deviation of the co-crystallized from its initial geometry when re-docked, was used to access the deviation. When the value of the RMSD is less than 2.0 Ã… for the re-docked pose and the co-crystallized pose, the docking protocol is accurate and fit to be used for the docking of other ligands to the receptor [32].
Identification and preparation of plant materials
The Sorghum bicolor grains were purchased from Osiele market, Abeokuta, Ogun State, Nigeria. The plant was taxonomically identified and authenticated at the Department of Botany, Federal University of Agriculture, Abeokuta, Ogun State, Nigeria. The Sorghum bicolor grains were air-dried in the dark and grounded into powder form prior to extraction and isolation.
Knowledge-based extraction of flavanones from Sorghum bicolor
The vHTS technique employed revealed eriodictyol, a flavanone, as the lead. Hence, flavanones were extracted from the grains of sorghum bicolor using the method described by Bazzocchi et al. [33]. The finely grounded powdery Sorghum bicolor grains (900 g) were extracted with ethanol (5 L) in a soxhlet apparatus for a period of 24 h at around 80 °C. The solvent obtained from soxhlet extraction was evaporated under reduced pressure in a rotary evaporator at ≤ 50 °C. The crude extract obtained was dissolved in 2.5 L of dichloromethane and allowed to stand for 48 h. It was filtered; the filtrate was slowly poured into a separating funnel (2 L) placed onto a metallic stand. The filtrate was allowed to settle into immiscible phases, the organic phase (bottom layer), and the aqueous phase (top layer). The top layer was gently decanted off. The organic phase (bottom layer) was recovered and exposed in the dark for the volatile dichloromethane to escape, leaving the flavanone extract. The extract was weighed and recorded.
Calculations,
Experimental animal
A sample size of 30 male Wistar rats was determined by using the G*Power 3 software for Mac OS [34], with the power set at 0.80, alpha probability at 0.05, and the effect size at 0.25. The Wistar rats weighing between 150 and 250 g were purchased from the Institute for Advanced Medical Research and Training (IAMRAT), College of Medicine, University of Ibadan, Nigeria. They were acclimatized for 2 weeks before the onset of the experiment. The animals were housed in a wooden cage with good aeration. The animals were subjected to 12 h of light and 12 h of darkness. The animals were given standard diets and water ad libitum. The study was carried out in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments in animals. The experimental protocols were also reviewed and approved by the Institutional Animal Ethics Committee (IAEC).
Experimental protocol
The experimental animals were randomized based on their body weight and allocated into six groups of five rats each:
-
i.
Group A (basal control): animals received normal chow and water ad libitum.
-
ii.
Group B (negative control): Animals received 1 ml distilled water p.o for 8 days, followed by a single oral administration of 0.15 M HCl/60% ethanol (ratio 1:1) [35] on the eight day and were sacrificed 5 h after.
-
iii.
Group C (positive control): Animals received 50 mg/kg body weight Diclofenac p.o for 8 days, followed by a single oral administration of 0.15 M HCl/ 60% ethanol (ratio 1:1) on the eight day and were sacrificed 5 h after.
-
iv.
Group D (test group): animals received 50 mg/kg body weight Sorghum bicolor extract p.o for 8 days, a single oral administration of 0.15 M HCl/60% ethanol (ratio 1:1) on the eight day, and were sacrificed 5 h after.
-
v.
Group E (test group): received 100 mg/kg body weight Sorghum bicolor extract p.o for 8 days, a single oral administration of 0.15 M HCl/60% ethanol (ratio 1:1) on the eight day, and were sacrificed 5 h after.
-
vi.
Group F (test group): received 100 mg/kg body weight Sorghum bicolor extracts p.o for 8 days and were sacrificed 5 h after.
Note: animals’ chow and water were withdrawn 24 h prior to sacrifice.
Sacrifice, blood collection, and organs excision
The experimental animals were sacrificed through cervical dislocation. The blood samples were collected via abdominal vein and centrifuged at 2500 rpm for 10 min. The supernatants were collected into clean Eppendorf tubes and stored for further biochemical assays. The Livers and the stomachs were also harvested, cleansed of superficial connective tissue in ice-cold normal saline, and later blotted with tissue paper and weighed. The tissues were homogenized for biochemical assays.
Preparation of tissue homogenates
The livers tissues were rinsed in cold sodium phosphate buffer (1:3, w/v), and subsequently homogenized with phosphate buffer, pH 7.4. The homogenate was centrifuged at 4000 rpm for 10 min, after which the clear supernatants were used for the various biochemical assays.
Biochemical assays
Determination of serum alanine aminotransferase activity
The alanine aminotransferase (ALT) activity was determined according to the method described in Lab Kit, Canovelles, Barcelona. One tablet of the substrate was dissolved in 15 ml of buffer, 30 μl of the sample was added to 300 μl of the working reagent, and the absorbance was taken every minute for 3 min at 340 nm [36].
Determination of serum aspartate aminotransferase activity
Aspartate aminotransferase (AST) activity was determined according to the method described in Lab Kit, Canovelles, Barcelona. One tablet of the substrate was dissolved in 15 ml of the buffer and 30 μl of the sample was added to 300 μl of the working reagent and the absorbance was taken every minute for 3 min at 340 nm [36].
Determination of liver superoxide dismutase activity
Superoxide dismutase activity was determined by the method of Zou et al. [37]. The medium for the estimation was prepared as shown in the table below and the reaction was allowed to run for 60 s each time for 3 min before the absorbance was read against the reagent blank at 340 nm.
 | Test (ml) | Blank (ml) |
Buffer | 0.10 | 0.15 |
Distilled water | 0.83 | 0.83 |
Sample | 0.05 | -------- |
Incubate at 25°C for 10 min. |  |  |
Pyrogallol | 0.02 | 0.02 |
Determination of lipid peroxidation
Lipid peroxidation was determined by measuring the formation of thiobarbituric acid reactive substances (TBARS) according to the method of Buege and Aust [38].
This method is based on the reaction between 2-thiobarbituric acid (TBA) and malondialdehyde.
Determination of liver reduced glutathione level
The method of Beutler et al. [39] was followed in estimating the level of reduced glutathione (GSH). Then, 0.2 ml of sample was added to 1.8 ml of distilled water and 3 ml of precipitating solution was mixed with sample. The mixture was allowed to stand for approximately 5 min and then filtered. At the end of the fifth minute, 1 ml of filtrate was added to 4 ml of 0.1 M phosphate buffer. Finally, 0.5 ml of Ellman’s reagent was added and the optical density was measured at 412 nm. A blank was prepared with 4 ml of the 0.1 M phosphate buffer, 1 ml of diluted precipitating solution, and 0.5 ml of the Ellman’s reagent.
Reverse transcription-polymerase chain reaction
The total RNA of the liver tissues was isolated using TRIzol reagent (Gibco). The RNA was dissolved with the RNA-free DNase (Roche, Switzerland) for a period of 15 min at a temperature of 37 °C. The RNeasy kit (Qiagen, Germany) was used to purify the RNA. The cDNA was synthesized by incubating 40 μg of the total RNA at 37 °C for a period of 1 h with the reverse transcriptase (GE Healthcare, UK) and also with random hexanucleotides, following the manufacturer’s instructions. The primers were designed using Snap gene software and ordered from Sigma-Aldrich, USA. The primers used to specifically amplify the genes of interest were,
Target gene | Forward 5′-3′ | Reverse 5′-3′ |
COX-2 | CTCAGCCATGCAGCAAATCC | GGGTGGGCTTCAGCAGTAAT |
COX-1 | TTGGAACTTCGAAGCCAT | CTGACAAGAAACAAGAACAAG |
Cyclophilin | TGGAGAGCACCAAGACAGACA | TGCCGGAGTCGACAATGAT |
Cyclophilin is the internal control gene. The genes were amplified for 50 cycles, 2 h and 20 min using the thermocycler. The amplified PCR products were run on 1.0% agarose gels and visualized with the aid of ethidium bromide (EtBr) staining [40].
Histopathology studies
The gastric mucosal tissues from the stomach of the experimental animals, groups A–F, were fixed in 10% buffered formalin (100 ml 37–40% formaldehyde, 4 g sodium phosphate monobasic, and 65 g of sodium phosphate dibasic in 900 ml of distilled water, pH 7.0) for 24 h [41]. The fixative was removed by washing with running water overnight. After dehydration, the tissues were cleaned in methyl-benzoate and embedded in paraffin wax. The section was cut into 3–5 μm thickness and later stained with hematoxylin and eosin. The sections were mounted and observed under light microscope.
Statistical analysis
The results obtained were expressed as the means ± standard error of mean (SEM). One-way analysis of variance (ANOVA) followed by Turkey’s multiple range tests and one-tailed test statistics were used to analyze the results. Conformation to the assumptions of the ANOVA test was ascertained. P < 0.05 were regarded as being significant, using the IBM-SPSS version 21.0 and GraphPad Prism version 7.0. The ImageJ software was used to quantify the bands from gene expression profiling (Fig. 1).
Results
Modeled protein validation
The modeled structure of COX-1 was validated using the Ramachadran plot (Fig. 2). From Fig. 2, there is a total of 99.6% of an allowed region and no disallowed region.
Molecular docking and virtual high throughput screening
The virtual high throughput screening revealed eriodictyol (docking scores of − 8.4 kcal/mol with COX-2 and − 7.8 kcal/mol with COX-1) (Fig. 1, Table 1), a flavanone as the lead compound (Table 1). In addition, the docking of other flavanones (Hesperetin and Naringenin) against COX-2 and COX-1 gave docking scores of − 8.5 kcal/mol and − 7.3 kcal/mol respectively with Hesperetin and docking scores of − 7.8 kcal/mol and − 6.7 kcal/mol respectively with Naringenin. Table 1 also shows the docking scores of standard selective inhibitors of both COX-2 and COX-1 (Fig. 3).
a Interactions of celecoxib (orange) with key residues at the catalytic site of COX-2, the dotted red lines represent the hydrophobic interactions while the blue lines represent hydrogen bonds interactions. b Interactions of celecoxib (orange) with key residues at the catalytic site of COX-1; the dotted red lines represent hydrophobic interactions while the blue lines represent hydrogen bonds interactions. c Interactions of eriodicytol (orange) with key residues at the catalytic site of COX-2; the dotted red lines represent hydrophobic interactions while the blue lines represent hydrogen bonds interactions. d Interactions of eriodicytol (orange) with key residues at the catalytic site of COX-1; the dotted red lines represent hydrophobic interactions, the blue lines represent hydrogen bonds interactions and the dotted green lines represent Pi-stacking
Validation of docking results
The co-crystallized, a benzopyran, (2R)-6,8-dichloro-7-(2-methylpropoxy)-2-(trifluoromethyl)-2H-chromene-3-carboxylic acid was re-docked back into the catalytic pocket of COX-2 (PDB ID: 3NTG). An RMSD value of 0.11 Ã… was observed (Fig. 4).
Biochemical assays
Serum alanine aminotransferase
The level of alanine aminotransferase (ALT) was significantly increased in the group of animals given HCl-ethanol only when compared with the basal control (Fig. 5a). The level of ALT was significantly attenuated in the groups that were pre-treated with Sorghum bicolor flavanone extract (SBFE) (50 mg/kg and 100 mg/kg). The level of ALT was also significantly reduced in the group given only SBFE (100 mg/kg) when compared with the basal control.
a Effect of SBFE on HCl/ethanol-induced changes in serum alanine aminotransferase activity. Values are expressed as mean ± Standard error of mean (n = 6/group). P < 0.05 is considered to be statistically significant. Bars with different alphabets are statistically significant. b Effect of SBFE on HCl/ethanol-induced changes in serum aspartate transaminase activity. Values are expressed as mean ± Standard error of mean (n = 6/group). P < 0.05 is considered to be statistically significant. Bars with different alphabets are statistically significant. c Effect of SBFE on HCl/ethanol-induced changes in hepatic reduced glutathione levels. Values are expressed as mean ± Standard error of mean (n = 6/group). P < 0.05 is considered to be statistically significant. Bars with different alphabets are statistically significant. d Effect of SBFE on HCl/ethanol-induced changes in hepatic superoxide dismutase activity. Values are expressed as mean ± Standard error of mean (n = 6/group). P < 0.05 is considered to be statistically significant. Bars with different alphabets are statistically significant. e Effect of SBFE on HCl/ethanol-induced changes in hepatic malondialdehyde (MDA). Values are expressed as mean ± Standard error of mean (n = 6/group). P < 0.05 is considered to be statistically significant. Bars with different alphabets are statistically significant
Serum aspartate aminotransferase
The level of aspartate aminotransferase (AST) was significantly increased in the group induced with HCl/ethanol only. There was no significant decrease in the level of serum AST in the group pre-treated with the diclofenac and later induced with HCl/ethanol when compared with the group induced with only HCl/ethanol (no pre-treatment) (Fig. 5b). However, there was a significant decrease in the level of serum AST in the groups pre-treated with 50 mg/kg and 100 mg/kg SBFE. In addition, there was a significant decrease in the level of serum AST in the group given only SBFE (Fig. 7) when compared with the group induced with HCl/ethanol only. No significant differences were observed in the groups pre-treated with 50 mg/kg, 100 mg/kg, and the group given only the SBFE when compared with the control.
Liver glutathione
The level of glutathione (GSH) was significantly reduced in the group administered with HCl/ethanol only, when compared with the basal control (Fig. 5c). The level of GSH was significantly reduced in the group pre-treated with 50 mg/kg diclofenac when compared with the basal control group and the group given only the HCl/ethanol. There was a significant increase in the level of GSH in the groups pre-treated with 50 mg/kg and 100 mg/kg SBFE when compared with the basal control (Fig. 5c).
The superoxide dismutase
As indicated in Fig. 5d, SBFE (50 mg/kg, 100 mg/kg, and 100 mg/kg of SBFE only) significantly elevated the level of SOD when compared with the basal control group and the groups administered HCl/ethanol only and diclofenac + HCl/ethanol. The SOD level was significantly decreased in the group administered HCl/ethanol only, and in the group pretreated with diclofenac (diclofenac + HCl/ethanol). In Fig. 5d, the SOD level of the group of animals given only 100 mg/kg of Sorghum bicolor flavanone extract (SBFE) was significantly increased when compared with the control.
Lipid peroxidation
The level of malondialdehyde (MDA) was significantly increased in the groups administered HCl/ethanol only and in the group pre-treated with diclofenac (Fig. 5e). However, there were no significant differences in the groups pre-treated with SBFE (50 mg/kg and 100 mg/kg) and the groups treated with only 100 mg/kg SBFE when compared with the control.
Gene expression profiling of the cyclooxygenases
COX-2 gene
In Fig. 6a, the administration of HCl/ethanol only (negative control) and diclofenac + HCl/ethanol (positive control) significantly upregulate the expression of COX-2 gene when compared with the basal control. However, in the groups pre-treated with SBFE (HCl + ETOH + 50 mg/kg and HCl + ETOH + 100 mg/kg), there was significant downregulation of the expression of the COX-2 gene when compared to the basal control, negative control, and positive control (Fig. 6a).
a Relative expression of COX-2 in the liver of rats in HCl/ethanol-induced inflammation. Values are expressed as mean ± Standard error of mean (n = 6/group). P < 0.05 is considered to be statistically significant. Bars with different alphabets are statistically significant. b Relative expression of COX-1 in the liver of rats in HCl/ethanol-induced inflammation. Values are expressed as mean ± Standard error of mean (n = 6/group). P < 0.05 is considered to be statistically significant. Bars with different alphabets are statistically significant
COX-1 gene
In Fig. 6b, COX-1 expression was upregulated in the negative control (HCl/ethanol only). There was no obvious downregulation in the expression of COX-1 in the positive control group and in the groups pre-treated with SBFE and later induced with HCl/ethanol (50 mg/kg and 100 mg/kg of SBFE) when compared with the negative control.
Histopathology analyses of the gastric mucosal tissues
Figure 7a reveals the microscopic view of the gastric mucosa tissue of the basal control. Figure 7b shows the microscopic view of the gastric mucosa tissue of the negative control (HCl/ethanol). Figure 7c shows the microscopic view of the gastric mucosa tissue of the positive control (diclofenac + HCl/ethanol). Figure 7d shows the microscopic view of the gastric mucosa tissue of the group pre-treated with 50 mg/kg Sorghum bicolor flavanone (SBFE). Figure 7e reveals the microscopic view of the gastric mucosa tissue of the group pre-treated with 100 mg/kg Sorghum bicolor flavanone extract (SBFE) while Fig. 7f reveals the microscopic view of the gastric mucosa tissue of the group treated with 100 mg/kg Sorghum bicolor flavanone extract (SBFE) only.
a The basal control group, magnification of × 100. b Negative control, magnification of × 400. c The positive control, magnification of × 400. d Effects of the pre-treatment of 50 mg/kg Sorghum bicolor flavanone (SBFE) on the gastric tissue of HCl/ethanol-induced inflammation in rats, magnification × 400. e Effects of the pre-treatment of 100 mg/kg Sorghum bicolor flavanone (SBFE) on the gastric tissue of HCl/ethanol-induced inflammation in rats, magnification × 400. f Effects of 100 mg/kg Sorghum bicolor flavanone extract (SBFE) only on the gastric tissue of the experimental animals, magnification × 100
Discussion
Modeled protein validation
The modeled structure of COX-1 possess 99.6% allowed region and no disallowed region as validated with the Ramachadran plot (Fig. 2), which shows that our model is good and a true representation of human COX-1.
Molecular docking and virtual high throughput screening
The virtual high throughput screening revealed eriodictyol (Fig. 1), a flavanone, as the lead compound (Table 1). In addition, molecular docking of other flavanones (hesperetin and naringenin) shows that they possess selective inhibitory potentials against COX-2 (Table 1).
This is in accordance with various reports that have hitherto implicated flavanones as anti-inflammatory compounds [42,43,44]. The selective potential of COX-2 inhibitors depends on the replacement of histidine 513 and isoleucine 523 of COX-1 with the smaller arginine and valine respectively. This replacement removes the restriction at the mouth of the secondary side channel and allows access for the bulkier selective COX-2 inhibitors [45]. It appears that the selectivity of inhibitors to COX-2 is due to hydrogen bonds interactions (Table 2) [46]. Eriodictyol forms two hydrogen bonds interactions (Tyr-371 and Ser-516) within the active site of COX-2, while it forms only one hydrogen bond (Met-521) with COX-1 (Fig. 3c, d).
Validation of docking results
The re-docked pose overlaps almost completely with the experimental orientation (Fig. 4). This gives credence to the accuracy of the auto-dock vina algorithm employed for molecular docking and virtual screening in the present study.
Biochemical assays
Serum alanine aminotransferase
An elevated serum alanine aminotransferase (ALT) and serum aspartate aminotransferase (AST) has been proposed as an indicator of alcohol-induced liver damage [47]. In the present study, the level of ALT was significantly increased in the group of animals given HCl-ethanol only when compared with the basal control (Fig. 5a). This is an indication of liver damages [47]. The level of ALT was significantly attenuated in the groups that were pre-treated with Sorghum bicolor flavanone extract (SBFE) (50 mg/kg and 100 mg/kg). The level of ALT was also significantly reduced in the group given only SBFE (100 mg/kg) when compared with the basal control. It is evident from the present study that SBFE possesses hepatoprotective effects; this is in agreement with the report of Agbaje et al. [48].
Serum aspartate aminotransferase
The level of AST was significantly increased in the group induced with HCl/ethanol only, indicating liver damage. There was no significant decrease in the level of serum AST in the group pre-treated with the diclofenac and later induced with HCl/ethanol when compared with the group induced with only HCl/ethanol (no pre-treatment) (Fig. 5b). However, there was a significant decrease in the level of serum AST in the groups pre-treated with 50 mg/kg and 100 mg/kg SBFE. In addition, there was a significant decrease in the level of serum AST in the group given only SBFE (Fig. 7) when compared with the group induced with HCl/ethanol only. No significant differences were observed in the groups pre-treated with 50 mg/kg, 100 mg/kg, and the group given only the SBFE when compared with the control. This confirms the hepatoprotective properties of Sorghum bicolor [48].
Liver glutathione
Glutathione (GSH) is an important antioxidant and cell-signaling regulator. GSH protect the cells against oxidative injury by reducing H2O2 and scavenging reactive oxygen and nitrogen radicals. In the present study, the level of GSH was significantly reduced in the group administered with HCl/ethanol only, when compared with the basal control (Fig. 5c). The reduced level of GSH may be as a result of HCl/ethanol-induced liver injury [49]. The level of GSH was significantly reduced in the group pre-treated with 50 mg/kg diclofenac when compared with the basal control group and the group given only the HCl/ethanol. The reduced level of GSH in this group (diclofenac + HCl/ethanol) may be as a result of synergistic oxidative loads of diclofenac and HCl/ethanol on the liver. Diclofenac has been reported to be hepato-toxic [50]. However, there was a significant increase in the level of GSH in the groups pre-treated with 50 mg/kg and 100 mg/kg SBFE when compared with the basal control (Fig. 5c). It is observed here that the Sorghum bicolor extract maintains the liver integrity by augmenting the antioxidant defense system of the liver.
The superoxide dismutase
Superoxide dismutase is a detoxifying enzyme; it is a component of the first line of the defense system against reactive oxygen species (ROS). Superoxide dismutase (SOD) is the first detoxification enzyme and most powerful antioxidant in the cell. It is an important endogenous antioxidant enzyme that acts as a component of first-line defense system against ROS [51]. It catalyzes the dismutation of two molecules of superoxide anion to hydrogen peroxide and molecular oxygen and in the process rendering the potentially harmful superoxide anion less hazardous. AS indicated in Fig. 5d, SBFE (50 mg/kg, 100 mg/kg, and 100 mg/kg of SBFE only) significantly elevated the level of SOD when compared with the basal control group and the groups administered HCl/ethanol only and diclofenac + HCl/ethanol. The SOD level was significantly decreased in the group administered HCl/ethanol only, and in the group pretreated with diclofenac (diclofenac + HCl/ethanol), it appears that the toxic effects of ethanol and diclofenac disrupt the antioxidant defense system of the liver and it is probably through the generation of free radicals [52]. As revealed in Fig. 5d, the SOD level of the group of animals given only 100 mg/kg of sorghum bicolor flavanone extract (SBFE) was significantly increased when compared with the control. The SBFE, due to its reported antioxidant properties [53], may act by augmenting the antioxidant SOD defense system of the liver.
Lipid peroxidation
The development of chronic liver damage has been shown to be associated with the onset of lipid peroxidation [54]. Malondialdehyde (MDA) has been reported to be the foremost product to evaluate lipid peroxidation [55]. The level of MDA was significantly increased in the groups administered HCl/ethanol only and in the group pre-treated with diclofenac (Fig. 5e). There were no significant differences in the groups pre-treated with SBFE (50 mg/kg and 100 mg/kg) and the groups treated with only 100 mg/kg SBFE when compared with the control. HCl/ethanol and diclofenac-induced lipid peroxidation; however, the SBFE protect the liver from lipid-peroxidation.
Gene expression profiling of the cyclooxygenases
COX-2 gene
The COX-2 gene encodes the inducible isozyme, cyclooxygenase-2. It is induced by specific inflammatory stimuli, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. In Fig. 6a, the administration of HCl/ethanol only (negative control) and diclofenac + HCl/ethanol (positive control) significantly upregulate the expression of COX-2 gene when compared with the basal control. However, in the groups pre-treated with SBFE (HCl + ETOH + 50 mg/kg and HCl + ETOH + 100 mg/kg), there were significant downregulation of the expression of the COX-2 gene when compared to the basal control, negative control, and positive control (Fig. 6a). It is obvious from the result herein (Fig. 6a) that SBFE downregulates the expression of the pro-inflammatory COX-2 gene. The anti-inflammatory potential demonstrated by SBFE (Fig. 6a) is likely due to its inhibition of COX-2.
COX-1 gene
This converts arachidonic acid to prostaglandin H2 (PGH2). It is involved in the constitutive production of prostanoids in particular in the stomach and platelets. It plays an important role in cytoprotection. It promotes platelet activation and aggregation, vasoconstriction, and proliferation of vascular smooth muscle cells through the generation of thromboxane A2 (TXA2). In Fig. 6b, COX-1 expression was upregulated in the negative control (HCl/ethanol only). However, there was no obvious downregulation in the expression of COX-1 in the positive control group and in the groups pre-treated with SBFE and later induced with HCl/ethanol (50 mg/kg and 100 mg/kg of SBFE) when compared with the negative control. The downregulation of the expression of COX-2 by SBFE (Fig. 6a) and the inability of the same SBFE to downregulate the expression of COX-1 (Fig. 6b) is likely due to the selective inhibition of COX-2 by SBFE.
Histopathology analyses of the gastric mucosal tissues
The gastric mucosal tissues from the stomach of the experimental animals from groups A–F were fixed in 10% buffered formalin and stained with hematoxylin and eosin. Figure 7a reveals the microscopic view of the gastric mucosa tissue of the basal control. In this group, there are locally extensive foci of mild erosion (blue arrow) of the surface covering epithelial cells of the gastric mucosa. There are a few foci of mild hyperplasia of mucus neck cells (red arrow). Other tunics show no visible lesion.
Figure 7b shows the microscopic view of the gastric mucosa tissue of the negative control (HCl/ethanol). In this group, all tunics appear fairly normal. There are a few amounts of inflammatory cells at the base of the mucosa (blue arrow).
Figure 7c shows the microscopic view of the gastric mucosa tissue of the positive control (diclofenac + HCl/ethanol). In this group, all tunics appear fairly normal. However, there are a few foci of mild cloudy degeneration of a few parietal cells (arrow).
Figure 7d shows the microscopic view of the gastric mucosa tissue of the group pre-treated with 50 mg/kg Sorghum bicolor flavanone (SBFE). There is a widespread loss (blue arrow) of mucous cells of the mucous glands of the tunica mucosa. Parietal cells (red arrow) show varying degrees of cloudy degeneration.
Figure 7e reveals the microscopic view of the gastric mucosa tissue of the group pre-treated with 100 mg/kg Sorghum bicolor flavanone extract (SBFE). All tunics appear normal. No visible lesion.
Figure 7f also reveals the microscopic view of the gastric mucosa tissue of the group treated with 100 mg/kg Sorghum bicolor flavanone extract (SBFE) only. All the tunics appear normal and there was no visible lesion.
The histopathological analyses demonstrate that SBFE is effective in the prevention of HCl/ethanol-induced gastric injury in Wistar rats (Fig. 7a–f). COX-1 inhibitors are associated with a number of side effects including gastrointestinal erosions and renal and hepatic insufficiency; SBFE demonstrates its anti-inflammatory potential without any of such effects (Fig. 7a–f).
Conclusion
The side effects of current NSAIDs are as a result of selective inhibition of COX-1. To the best of our knowledge, nothing has been reported so far on the selective inhibition of COX-2 by flavanones. The present study established that flavanones are selective inhibitors of COX-2. This study shows that novel and potent hits could be generated via the virtual high throughput screening techniques applied herein.
Availability of data and materials
The data and materials for this study are available on request.
Abbreviations
- COX-1:
-
Cyclooxygenase-1
- COX-2:
-
Cyclooxygenase-2
- ETOH:
-
Ethanol
- pdb:
-
Protein data bank
- pdqt formats:
-
Protein data bank charged format
- SBFE:
-
Sorghum bicolor flavanone extract
- Sdf format:
-
Structure data format
- vHTS:
-
Virtual high throughput screening
References
Medzhitov R (2008) Origin and physiological roles of inflammation. Nature 445:153
Parham P (2000) The immune system, Chapter 1. Elements of the immune systems and their roles in defense. Garland Publishing, New York, pp 1–31
Maffetone, P. (2002). The ABCs of chronic inflammation. [Online]. Available http://content.bandzoogle.com/users/cippianhotmail/files/ABCs_of_Inflammation_update_4-08(1).pdf.
Vane JR, Botting RM (1998) Anti-inflammatory drugs and their mechanism of action. Inflammation Research 47(Supplement 2):S78–S87
Wang HJ, Zakhari S, Jung MK (2010) Alcohol, inflammation, and gut-liver-brain interactions in tissue damage and disease development. World Journal of Gastroenterology 16(11):1304–1313 https://doi.org/10.3748/wjg.v16.i11.1304
Ito M, Shii D, Segami T, Kojima R, Suzuki T (1992) Preventive action of N-(3-aminopropionyl)-L-hitidinato zinc (Z-103) through increases in the activities of oxygen derived free radicals scavenging enzymes in the gastric mucosa on ethanol induced gastric mucosal damage in rats. Japanese Journal of Pharmacology 59:267
Goel RK, Sairam K (2002) Antiulcer drugs from indigenous sources with emphasis on Musa sapientum, Tamrabhasna, Asparagus racemosus and Zingiber officinale. Indian Journal of Pharmacology 34:100–110
Amirghofran Z (2012) Herbal medicines for immunosuppression. Indian Journal of Pharmacology 11:111–119
Kontoyianni M (2017) Docking and virtual screening in drug discovery. Proteomics for Drug Discovery:255–266. https://doi.org/10.1007/978-1-4939-7201-2_18
Sethia, Joshi K, Sasikala K, Alvala M (2019) Molecular docking in modern drug discovery: principles and recent applications. IntechOpen. https://doi.org/10.5772/intechopen.85991
Kumar S, Sinha K, Sharma R, Purohit R, Padwad Y (2019) Phloretin and phloridzin improve insulin sensitivity and enhance glucose uptake by subverting PPARγ/Cdk5 interaction in differentiated adipocytes. Experimental Cell Research. S0014-4827(19):30320–30329. https://doi.org/10.1016/j.yexcr.2019.06.025
Tanwar G, Purohit R (2019) Gain of native conformation of Aurora A S155R mutant by small molecules. Journal of Cellular Biochemistry. https://doi.org/10.1002/jcb.28387
Shah BN, Seth AK, Maheshwari KM (2011) A review on medicinal plants as a source of anti-inflammatory agents. Research Journal of Medicinal Plants 5:101–115
Bayan L, Koulivand PH, Gorji A (2014) Garlic: a review of potential therapeutic effects. Avicenna Journal of Phytomedicin 4(1):1–14
Sharma P, Amit C, Kharkwal AC, Kharkwal H, Abdin MZ, Varma A (2014) A review on pharmacological properties of Aloe vera. International Journal of Pharmaceutical Sciences Review and Research 29(2):31–37
Louay L (2014) Medicinal and pharmacological properties of turmeric (Curcuma longa) A review. International Journal of Pharmacy and Biomedical Sciences 5(1):17–35
Shah G, Shri R, Panchal V, Sharma N, Singh B, Mann AS (2011) Scientific basis for the therapeutic use of Cymbopogon citratus, stapf (Lemon grass). Journal of Advanced Pharmaceutical Technology and Research 2(1):3–8 https://doi.org/10.4103/2231-4040.79796
Yakubu MT, Ajiboye TO, Akanji MA (2014) Toxicity and beneficial effects of some african plants on the reproductive system. Toxicological Survey of African Medicinal Plant:445–492
Minaiyan M, Asghari G, Taheri D, Saeidi M, Nasr-Esfahani S (2014) Anti-inflammatory effect of Moringa oleifera Lam. seeds on acetic acid-induced acute colitis in rats. Avicenna Journal of Phytomedicine 4(2):127–136
Nacoulma AP, Compaore M, Lorenzi M, Kiendrebeogo M, Nacoulma OG (2012) In vitro antioxidant and anti-inflammatory activities of extracts from Nicotiana tabacum L. (Solanaceae) leafy galls induced by Rhodococcus fascians. Journal of Phytopathology. https://doi.org/10.1111/j.1439-0434.2012.01953.x
Ajayi A, Tanayen J, Ezeonwumelu J, Dare S, Okwanachi A, Adzu B, Ademowo O (2014) Anti-inflammatory, anti-nociceptive and total polyphenolic content of Hydroethanolic extract of Ocimum gratissimum L. leaves. African Journal of Medicine and Medical Sciences 43(Suppl 1):215–224
Jang M, Jeong S, Cho SK, Ahn KS, Lee JH, Yang DC, Kim J (2014) Anti-inflammatory effects of an ethanolic extract of guava (Psidium guajava L.) leaves in vitro and in vivo. Journal of Medicinal Food 17(6):678–685. https://doi.org/10.1089/jmf.2013.2936
Benson KF, Beaman JL, Ou B, Okubena A, Okubena O, Jensen GS (2013) West African Sorghum bicolor leaf sheaths have anti-inflammatory and immune-modulating properties in vitro. Journal of Medicinal Food 16(3):230–238 https://doi.org/10.1089/jmf.2012.0214
Erah PO, Asonye CC, Okhamaf AO (2003) Response of Trypanosoma brucei brucei–induced anaemia to a commercial herbal preparation. African Journal of Biotechnology 2:307–311
Oladiji AT, Jacob TO, Yakubu MT (2007) Anti-anaemic potentials of aqueous extract of Sorghum bicolor (L.) Moench stem bark in rats. Journal of Ethnopharmacology 111:651–656
Wang JL, Limburg D, Graneto MJ, Springer J, Hamper JRB, Liao S, Pawlitz JL, Kurumbail RG, Maziasz T, Talley JT, Kiefer JR, Carter J (2010) The novel benzopyran class of selective cyclooxygenase-2 inhibitors. Part 2: The second clinical candidate having a shorter and favorable human half-life. Bioorganic and Medicinal Chemistry Letters. 20:7159–7163
Bordoli L, Kiefer F, Arnold K, Benkert P, Battery J, Schwede T (2009) Protein structure homology modelling using Swiss-MODEL workspace. Nature Protocols
Harman CA, Turman MV, Kozak KR, Marnett LJ, Smith WL, Garavito RM (2007) Structural basis of enantioselective inhibition of cyclooxygenase-1 by S-α-substituted indomethacin ethanolamides. The Journal of Biological Chemistry 282(38):28096–28105
Laskowski RA, Rullmannn JA, MacArthur MW, Kaptein R, Thornton JM (1996) AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR. Journal of Biomolecular NMR 8:477–486 [PubMed id: 9008363]
Shoichet BK (2004) Virtual screening of chemical libraries. Nature 432(7019):862–865
Durrant JD, Amaro RE, McCammon JA (2009) AutoGrow: a novel algorithm for protein inhibitor design. Chemical Biology and Drug Design 73:168–178
Morris GM, Goodsell DS, Halliday RS, Huey R, Hart WE, Belew RK, Olson AJ (1998) Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function. Journal of Computational Chemistry 19:1639–1662
Bazzocchi IL, Ticona JC, Jiménez IA, Flores N (2016) Isolation of flavonoids from Piper delineatum leaves by chromatographic techniques. Bio protocols. 6(I):14 www.bio-protocol.org/e1867
Faul F, Erdfelder E, Buchner A, Lang AG (2009) Statistical power analyses using G*Power 3.1: Tests for correlation and regression analyses. Behavior Research Methods 41:1149–1160
Qian Y, Li G, Zhu K, Sun P, Feng X, Zhao X (2013) Effect of resistant starch on HCl/ethanol-induced gastric injury in rats. Journal of the Korean Society for Applied Biological Chemistry 56:613–619. https://doi.org/10.1007/s13765-013-3143-4
Murray R (1984) Aspartate aminotransferase. In: Kaplan A et al (eds) Clin Chem The C.V. Mosby Co. Princeton, St Louis, pp 1112–1116
Zou GL, Gui XF, Zhong XL, Zhu YF (1986) Improvement in pyrogallol autoxidation method for the determination of SOD activity. Progress in Biochemistry and Biophysics 4:71–73
Buege JA, Aust SD (1978) Microsomal lipid peroxidation. Methods in Enzymology 52:302–310
Beutler E, Duron O, Kelly BM (1963) Improved method for the determination of blood glutathione. Journal of Laboratory and Clinical Medicine 61:882–888
Zhao X, Deng XX, Park KY, Qiu LH, Pang L (2013) Purple bamboo salt has anticancer activity in TCA8113 cells in vitro and preventive effects on buccal mucosa cancer in mice in vivo. Experimental and Therapeutic Medicine 5:549–554
Raghuramulu N, Madhavan KN, Kalyansundhram S (1983) A manual of laboratory techniques. NIN, ICMR, Silver Prints, Hyderabad, India
Yilma AN, Singh SR, Dennis VA (2013) Flavonoid naringenin: a potential immunomodulator for Chlamydia trachomatis inflammation. Mediators of Inflammation 102457. https://doi.org/10.1155/2013/102457
Yang HL, Chen SC, Kumar SKJ, Yu KN, Chao LPD, Tsai SY, Hou YC (2012) Antioxidant and anti-inflammatory potential of hesperetin metabolites obtained from hesperetin-administered rat serum: an ex vivo approach. Journal of Agricultural and Food Chemistry, 11 60(1):522–532. https://doi.org/10.1021/jf2040675
Bzeouich IM, Mutsapha N, Sassi A, S. (2016) Investigation of immunomodulatory and anti-inflammatory effects of eriodictyol through its cellular anti-oxidant activity. Cell Stress and Chaperones 21(5):773–781
Limongellia, V., Bonomia, M., Marinellib, L., Gervasioc, FL, Cavallid, A, Novellinob, E, and Parrinelloa, M. (2010). Molecular basis of cyclooxygenase enzymes (COXs) selective inhibition. www.pnas.org/cgi/doi/10.1073/pnas.0913377107
Hermanson DJ, Gamble-George JC, Marnett LJ, Patel S (2014) Substrate-selective COX-2 inhibition as a novel strategy for therapeutic endocannabinoid augmentation. Trends in Pharmacological Sciences 35(7):358–367 https://doi.org/10.1016/j.tips.2014.04.006
Masano L, Mendez C, Hill D, Barve S, Macclain CJ (2003) Diagnosis and treatment of alcoholic liver diseases and its complications. Alcohol Research and Health 27(3):247–256
Agbaje MA, Nwoha PU, Adekomi DA, Olayode AA, Bamisi OD (2018) Tract of sorghum bicolor leaf sheath on paracetamol induced liver damage in rats. Journal of Medicine and Medical Sciences 9(1):009–014
Yuan L, Kaplowitz N (2009) Glutathione in liver diseases and hepatotoxicity. Molecular Aspects of Medicine:29–41
Boelsterl UA (2003) Diclofenac-induced liver injury: a paradigm of idiosyncratic drug toxicity. Toxicology and Applied Pharmacology 192(3):307–322
Ighodaro, OM and Akinloye, OA (2017). First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria Journal of Medicine. In press
Rasineni K, Casey CA (2012) Molecular mechanism of alcoholic fatty liver. Indian Journal of Pharmacology 44(3):299–303 https://doi.org/10.4103/0253-7613.96297
Dykes L, Rooney IW, Waniska RD, Rooney WI (2005) Phenolic compounds and antioxidant activity of sorghum grains of varying genotypes. Journal of Agricultural and Food Chemistry 53:6813–6818
Parola M, Leonarduzzi G, Robino G, Albano E, Poli G, Dianzani M (1996) On the role of lipid peroxidation in the pathogenesis of liver damage induced by long-standing cholestasis. Free Radical Biology and Medicine 20(3):351–359
Grotto D, Maria LS, Valentini J, Paniz C, Garcia GSS (2009) Importance of the lipid peroxidation biomarkers and methodological aspects for malondialdehyde quantification. QuÃmica Nova 32(1):169–174
Acknowledgements
We acknowledgement the Director of the Centre for Bio-computing and Drug Development, Adekunle Ajasin University Akungba-Akoko, Nigeria, Dr. I.O. Omotuyi for the use of the facilities at the Centre to carry some aspect of the research work.
Funding
Not applicable.
Author information
Authors and Affiliations
Contributions
AOA proposed, design, and supervised the study, and he also edited the manuscript. MDS took part in all aspects of the study and wrote the manuscript. ADI wrote part of the manuscript, carried out biochemical assays, and analyzed the data. OSB carried out the in-silico screening, biochemical assays, and analyzed the data. OIA carried out the in-silico screening, the biochemical assays, and analyzed the data. OF carried out the in-silico screening and the biochemical assays. BOA participated in the Molecular Gene Expression profiling while OO participated in the histopathological analysis. All authors have read and approved the manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
The study was carried out in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments in animals. The experimental protocols were reviewed and approved by the Institutional Animal Ethics Committee (IAEC) with the acceptance number, FUNAAB/ IAEC /1712001.
Consent for publication
The consent for publication is obtained from all the authors.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.
About this article
Cite this article
Akinloye, O.A., Metibemu, D.S., Akinloye, D.I. et al. Flavanones from Sorghum bicolor selectively inhibit COX-2: in-silico and in-vivo validation. Egypt J Med Hum Genet 20, 34 (2019). https://doi.org/10.1186/s43042-019-0029-y
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s43042-019-0029-y