Skip to main content
Egyptian Journal of Medical Human Genetics
Download PDF

Association between the single-nucleotide polymorphism (rs1030868) variant in matrix metallopeptidase 2 gene and the development of lymphedema

Egyptian Journal of Medical Human Genetics volume 24, Article number: 27 (2023) Cite this article

Abstract

Background

Understanding the genetic and molecular pathophysiology of lymphedema contributes to the identification of the complex interaction of genes associated with lymphedema and provides a key therapeutic opportunity to restore lymphatic function. This study aims to answer whether the single-nucleotide polymorphism (SNP) rs1030868 in the MMP-2 gene could be an associated variant in lymphedema development.

Methods

This study was carried out on 93 lymphedema cases (patients’ group) and 187 healthy individuals (control group). Genotyping of MMP-2 (rs1030868) was done following the protocol of Custom TaqMan® SNP Genotyping Assays. TaqMan™ Fast Advanced Master Mix (Cat# 4448892) was used.

Results

The risk alleles for MMP-2 SNP rs1030868 were A and G of lymphedema development. The GG genotype was associated with triple the risk of lymphedema (OR 3.2, 95% CI 1.2–6.5, p = 0.019), while the AA genotype was associated with 5.9 times the likelihood of lymphedema (OR 5.9, 95% CI 2.3–11.9, p < 0.001).

Conclusions

We concluded that the single-nucleotide polymorphisms of rs1030868 in the matrix metallopeptidase 2 gene (allele A and allele G) could be associated variants with the development of lymphedema.

Background

Lymphedema is a common chronic debilitating swelling resulting from disruption of the lymphatic system. It is characterized by the progressive accumulation of protein-rich fluid within the interstitium, fibro adipose tissue deposition, chronic inflammation, and recurrent infections [1]. It affects about 250 million patients worldwide [2]. Lymphedema can be categorized as either primary or secondary. Primary lymphedema is caused by abnormal development of the lymphatic system. These developmental abnormalities may be related to genetic defects that either directly or indirectly regulate lymphatic differentiation and function [3].

Secondary lymphedema is the most common cause of lymphedema and develops secondary to injury of the lymphatic system by surgery, radiation, trauma, or infection. Lymphatic filariasis is the most common cause of secondary lymphedema worldwide. It is caused by three species of nematodes transmitted by mosquitoes: Wuchereria bancrofti, Brugia malayi, and Brugia timori [4].

Different pathways contribute in the pathophysiology of lymphedema. Lymphatic injury promotes infiltration of T-helper cells, cytokines, growth factors, and collagen deposition, decreases collateral lymphatic formation, increases lymphatic leakiness, and impairs collecting lymphatic vessel pumping [5].

Understanding the molecular pathophysiology of lymphedema based on genetic information leads to the discovery of lymphatic markers and mechanisms that regulate lymphangiogenesis and the mutations in the coding or noncoding regions of genes associated with primary and secondary lymphedema [6].

The matrix metallopeptidase 2 gene is involved in the remodeling of the vasculature, angiogenesis, tissue repair, and inflammation. The polymorphisms of MMP-2 (rs1030868) can predispose to secondary lymphedema and/or modulate the clinical course of lymphedema. A higher risk of secondary lymphedema is associated with the A allele [7].

Angiogenic and lymphangiogenic molecules such as vascular endothelial growth factors (VEGFs) are elevated in the plasma of lymphedema patients. Polymorphism in FOXC-2 and FLT-4 genes have been identified to be involved in chronic lymphedema. Understanding lymphangiogenic mechanisms provide a therapeutic key for better interstitial fluid drainage, lipid absorption, and immune response [8].

Based on previous studies, we investigate the association between the single-nucleotide polymorphism (rs1030868) in the matrix metallopeptidase 2 (MMP-2) gene and the development of lymphedema.

Subjects and methods

This study was carried out on 93 lymphedema cases (patients’ group) and 187 healthy individuals (control group). Lymphedema examination and staging were done [9].

Sampling

Two mL of EDTA peripheral blood samples were collected from patients and controls for the detection of circulating filarial antigen (CFA) and DNA extraction. Filariasis test strip (FTS) was used for the determination of circulating filarial antigen [10].

DNA extraction

Extraction of DNA was performed using the QIAamp® DNA Blood Mini Kit following the manufacturer's recommendations (QIAGEN's EMEA headquarters in Hilden, Germany). DNA was eluted in approximately 200 μL of buffer AE. The extracted DNA was stored frozen at − 20 °C. Quantification of isolated DNA was performed spectrophotometrically using the NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA) and the samples were measured at 17–45 ng/μL.

SNP genotyping

Single-nucleotide polymorphism (SNP) is a location of genetic variation in the genome that varies between individuals. Each SNP represents a difference in a single DNA nucleotide. The variant rs1030868 (reference SNP cluster ID) is an intron variant of the matrix metallopeptidase 2 (MMP-2) gene on chromosome 16 [11].

Rotor-Gene Q 5plex HRM Platform (Real-time PCR cycler and High-Resolution Melt analyzer) was used. A High-Resolution Melt analyzer (HRM) characterizes double-stranded PCR products based on their dissociation (melting) behavior (QIAGEN's EMEA headquarters in Hilden, Germany). The operating software was Rotor-Gene Q 2.3.4.3—Windows platforms—(EN). The detection of rs1030868 followed the protocol of Custom TaqMan® SNP Genotyping Assays manufacturing kits (Thermo Fisher Scientific, USA). TaqMan® SNP Genotyping Assays allow for genotyping of nucleotide polymorphisms using the 5′-nuclease assay for amplifying and detecting specific alleles in purified genomic DNA samples.

Each TaqMan® Genotyping Assay contains two primers for amplifying the sequence of interest and two TaqMan® MGB probes for allele detection. The presence of two probes in each reaction allows for genotyping of two possible variant alleles at the polymorphic site in a DNA target sequence (Context Sequence [VIC/FAM]: TGATTGCTACAGCCTGCTTTGGTCA[A/G] TACTGTGCCATCCTAATGTGGCTAA). The genotyping assay determines the presence or absence of polymorphism based on the change in fluorescence of the dyes associated with the Probes. The TaqMan® MGB Probes consist of target-specific oligonucleotides with a reporter dye linked to the 5′-end of each probe Fig. 1. The FAM™ dye is attached to the guanine (G) base and gives a fluorescence green color. The VIC® dye attaches to the adenine (A) base and gives yellow fluorescence color.

Fig. 1
figure 1

Mechanism of the TaqMan SNP genotyping assay according to the manufacturing kits (Thermo Fisher Scientific, USA)

Full size image

TaqMan™ Fast Advanced Master Mix (Life Technologies, Cat# 4448892) was used according to the manufacturer’s instructions. The order of DNAs from cases and controls was arranged in a 72-well plate over six runs with duplication of four samples all over the runs for quality control purposes. The thermal cycler profile is shown in Table 1.

Table 1 Thermal cycler profile
Full size table

Statistical analysis

The data collected were tabulated and analyzed by statistical package for social science version 23.0 on IBM compatible computer. Frequency and percentage were used for the description of these qualitative data. The Chi-square test was used to measure the relationship between two or more qualitative variables. The results were considered significant when the P value was < 0.05.

Results

The patient's characteristics are shown in Table 2. In the patient's group, 61% of them were females and 39% were males. Of 93 patients complaining of lower limb lymphedema, seven cases were primary lymphedema and 86 cases were secondary lymphedema. All cases and controls were negative for circulating filarial antigen. In the patient's group, 26% were stage IV lymphedema and 20% were Stage VI.

Table 2 Demographic and lymphedema stages of cases and control
Full size table

The association between demographic characteristics and disease stage is presented in Table 2. There was a significant (p < 0.001) difference in the mean age between the various stages. For pairwise comparisons, patients of stage IV lymphedema (n = 25) were significantly (p = 0.015) older than those of stage VII (n = 8). There was a significant association between the disease stage and sex of the patient (p < 0.001), i.e., sex distribution was as follows: 100% of stage I cases were females, equal distribution was observed in stage III and VII, stage II cases had almost equal sex distribution (7/6), in stage IV females represented 60%, stage V had the reverse (males represented about two-thirds), and most of stage VI cases were females (84%).

As shown in Table 3 and Fig. 2, compared with the wild genotype (GA), the GG genotype was associated with triple the risk of lymphedema (OR 3.2, 95% CI 1.2–6.5, p = 0.019) while the AA genotype was associated with 5.9 times the likelihood of lymphedema (OR 5.9, 95% CI 2.3–11.9, p < 0.001).

Table 3 Genotype frequency and OR for SNP associated with disease status
Full size table
Fig. 2
figure 2

VIC/FAM dye fluorescence on cycle number

Full size image

Table 4 shows the distribution of genotype frequency according to disease determinants. The three genotype groups were matched for age and sex (p = 0.686 and 0.575). For the stage of disease, there was a significant difference in genotype frequency for lymphedema staging (p = 0.007). In other words, AA genotype frequency was higher in stage VI (56%), followed by stages IV and VII (19%), then stage V (6%) and 0% in stages I–III. For GA, the higher frequency was reported in stage IV (30%), stage II (16.5%), stage V (15%), stages III and VI (12%), and stages I and VII (7.5%). Regarding GG frequency, a higher percentage was observed in the stages from stage II to stage VI with 0% in stages I and VII.

Table 4 Relationship between genotype frequency and determinants
Full size table

Discussion

Studying the genetic basis of lymphedema could facilitate risk prediction susceptibility, understanding the host immunogenetics, and the development of effective drug therapy [12]. Host immune response plays an integral role in lymphedema molecular pathogenesis by inducing the expression of particular genes [13].

In this study, the genotyping for MMP-2 (rs1030868) was done to answer the question is there is an association between this SNP variant and lymphedema development.

According to National Center for Biotechnology Information (NCBI), MMP-2 is a member of the matrix metallopeptidase (MMP) gene family. It provides instructions for making enzymes called matrix metallopeptidase 2 which are zinc-dependent enzymes capable of cleaving components of the extracellular matrix and molecules involved in signal transduction. The protein encoded by this gene is a type IV collagenase and gelatinase A, which contains three fibronectin type II repeats in its catalytic site that allows the binding of denatured type IV and V collagen and elastin.

The matrix metallopeptidase 2 is an angiogenic factor involved in multiple physiological pathways including roles in the nervous system, endometrial menstrual breakdown, regulation of vascularization, tissue repair, and bone remodeling [14].

Although MMP gene expression is primarily regulated at the transcriptional level, posttranscriptional control of mRNA stability by cytokines, nitric oxide, or micro-RNA (miRNA) has been described as a significant contributing mechanism [15]. The matrix metallopeptidase 2 enzyme can be activated extracellularly by proteases or intracellularly by its S-glutathionylation with no requirement for proteolytical removal of the prodomain [16].

The MMP-2 expression and activity are tightly regulated via interactions between their activators and inhibitors. Imbalance among these factors results in dysregulated MMP-2 activity, which causes tissue destruction and functional alteration such as cardiovascular disease, neurodegenerative disease, Nodulosis–Arthropathy–Osteolysis (NAO) syndrome, inflammation as well as cancer, thus highlighting MMPs as promising therapeutic targets [17].

In the current study, the heterozygous wild-type GA was 72% (67 cases) in the patient’s group and 92% (172 individuals) in the control group. MMP-2 (rs1030868) genotyping for filarial lymphedema in a cross-sectional study showed that the GA genotype was 47% in the patient group and 49% in the control group [18].

In our research, the patients with AA genotype (rs1030868) were associated with 5.9 times the likelihood of lymphedema (OR 5.9, 95% CI 2.3–11.9, p < 0.001). The GG genotype was associated with triple the risk of lymphedema (OR 3.2, 95% CI 1.2–6.5, p = 0.019).

In another study, the authors concluded that patients with MMP-2 (rs1030868) minor allele A SNP have a 1.3-fold risk of developing lymphedema than those who do not have these alleles [18].

MMPs participate in aging processes by destroying collagen in the dermis and breakdown of proteins in the ECM and the basement membrane. Metallopeptidase (MMP-2) also is involved in vascular remodeling and angiogenesis [19].

MMP-2 mRNA levels are known to be higher in lymphedematous specimens compared to non-lymphedematous specimens of progenitor cells [20] and a blockage or downregulation of this gene leads to reduced lymphangiogenesis, so the MMP-2 gene might have a role in lymphedema development [21].

The overexpression of MMP-2 alters and remodels the extracellular matrix which leads to disruption of the tight junctions with destruction and remodeling of the lymphatic vessel’s architecture leading to lymphangiectasia, lymph stasis, and the lymph fluid entering the surrounding tissue causing lymphedema [18].

The filarial lymphedema with or without active infection is characterized by elevated levels of circulating MMPs. Altered ratios of matrix metallopeptidase (MMP)/tissue-inhibitors of metallopeptidase (TIMP) are an important underlying factor in the pathogenesis of tissue fibrosis in filarial lymphatic disease. There is an association between Type 2 cytokines, MMPs, and TIMPs in filarial infection which result in persistent and progressive tissue fibrosis [22]. There is an interaction between genes associated with lymphedema. There was a positive correlation between MMP-2 and VEGF expression; therefore, inhibition of MMP-2 may result in synergistic effects with other factors in this pathway [23].

The level of MMP-2 mRNA is higher in patients with disorders of the lymph flow of the extremities. Blocking or experimental reduction of MMP-2 gene activity leads to a decrease in lymphatic angiogenesis. The increased amount of MMP-2 may change and reconstruct the extracellular matrix around the vessels which promotes impaired vascular density and extravasation of lymph to the surrounding tissues [24].

Conclusion

The significant association of MMP-2 SNP rs1030868 is an indication that this gene might be involved in lymphedema development. There is a significant difference in genotype frequency for lymphedema staging (severity of lymphedema). The AA genotype frequency was higher in the advanced stages of lymphedema. The results of this study may contribute to understanding the genetic base of lymphedema. A large-scale study is needed to identify the complex interaction of genes associated with lymphedema.

Availability of data and materials

Not applicable.

References

  1. Li CY, Kataru RP, Mehrara BJ (2020) Histopathologic features of lymphedema: a molecular review. Int J Mol Sci 21(7):2546

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Schulze H, Nacke M, Gutenbrunner C, Hadamitzky C (2018) Worldwide assessment of healthcare personnel dealing with lymphoedema. Heal Econ Rev 8(1):1–1

    CAS  Google Scholar 

  3. Martin-Almedina S, Mortimer PS, Ostergaard P (2021) Development and physiological functions of the lymphatic system: insights from human genetic studies of primary lymphedema. Physiol Rev 101(4):1809–1871

    Article  CAS  PubMed  Google Scholar 

  4. Chachaj A, Piller N, Boccardo F, Szuba A (2022) Lymphedema: general pathophysiology, prevention, and management in invasive cancer. In: Leong SP, Nathanson SD, Zager JS (eds) Cancer metastasis through the lymphovascular system. Springer, Cham, pp 261–271

    Chapter  Google Scholar 

  5. Kiwanuka E, Mehrara B (2022) Pathophysiology and molecular research in lymphedema. In: Schaverien MV, Dayan JH (eds) Multimodal management of upper and lower extremity lymphedema. Springer, Cham, pp 15–21

    Chapter  Google Scholar 

  6. Hespe GE, Nitti MD, Mehrara BJ (2015) Pathophysiology of lymphedema. Lymphedema 2015:9–18

    Article  Google Scholar 

  7. Michelini S, Cestari M, Michelini S, Camilleri G, De Antoni L, Nelson W, Bertelli M (2020) Study of a supplement and a genetic test for lymphedema management. Acta Bio Med Atenei Parm 91(Suppl 13):e2020013

    CAS  Google Scholar 

  8. Wong AK, Raghuram AC (2022) New and emerging therapies for lymphedema: part I. In: Schaverien MV, Dayan JH (eds) Multimodal management of upper and lower extremity lymphedema. Springer, Cham, pp 199–208

    Chapter  Google Scholar 

  9. Dreyer G, Addiss D, Dreyer P, Norões J (2002) Basic lymphoedema management: treatment and prevention of problems associated with lymphatic filariasis. Hollis Publishing Company, Hollis, p 112

    Google Scholar 

  10. Sheel M, Lau CL, Sheridan S, Fuimaono S, Graves PM (2021) Comparison of immunochromatographic test (ICT) and filariasis test strip (FTS) for detecting lymphatic filariasis antigen in American Samoa, 2016. Trop Med Infect Dis 6(3):132

    Article  PubMed  PubMed Central  Google Scholar 

  11. https://www.ncbi.nlm.nih.gov/snp/rs1030868#seq_hash

  12. Newman B, Lose F, Kedda MA, Francois M, Ferguson K, Janda M, Yates P, Spurdle AB, Hayes SC (2012) Possible genetic predisposition to lymphedema after breast cancer. Lymphat Res Biol 10(1):2–13

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Pfarr KM, Debrah AY, Specht S, Hoerauf A (2009) Filariasis and lymphoedema. Parasite Immunol 31(11):664–672

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Bennuru S, Nutman TB (2009) Lymphangiogenesis and lymphatic remodelling induced by filarial parasites: implications for pathogenesis. PLoS Pathog 5(12):e1000688

    Article  PubMed  PubMed Central  Google Scholar 

  15. Löffek S, Schilling O, Franzke CW (2011) Biological role of matrix metalloproteinases: a critical balance. Eur Respir J 38(1):191–208

    Article  PubMed  Google Scholar 

  16. Jabłońska-Trypuć A, Matejczyk M, Rosochacki S (2016) Matrix metalloproteinases (MMPs), the main extracellular matrix (ECM) enzymes in collagen degradation, as a target for anticancer drugs. J Enzyme Inhib Med Chem 31(sup1):177–183

    Article  PubMed  Google Scholar 

  17. Tokito A, Jougasaki M (2016) Matrix metalloproteinases in non-neoplastic disorders. Int J Mol Sci 17(7):1178

    Article  PubMed  PubMed Central  Google Scholar 

  18. Debrah LB, Albers A, Debrah AY, Brockschmidt FF, Becker T, Herold C, Hofmann A, Osei-Mensah J, Mubarik Y, Fröhlich H, Hoerauf A (2017) Single nucleotide polymorphisms in the angiogenic and lymphangiogenic pathways are associated with lymphedema caused by Wuchereria bancrofti. Hum Genom 11(1):1–3

    Article  Google Scholar 

  19. Kim IS, Yang WS, Kim CH (2022) Physiological properties, functions, and trends in the matrix metalloproteinase inhibitors in inflammation-mediated human diseases. Curr Med Chem 30:2075–2112

    Google Scholar 

  20. Couto RA, Kulungowski AM, Chawla AS, Fishman SJ, Greene AK (2011) Expression of angiogenic and vasculogenic factors in human lymphedematous tissue. Lymphat Res Biol 9(3):143–149

    Article  CAS  PubMed  Google Scholar 

  21. Detry B, Erpicum C, Paupert J, Blacher S, Maillard C, Bruyère F, Pendeville H, Remacle T, Lambert V, Balsat C, Ormenese S (2012) Matrix metalloproteinase-2 governs lymphatic vessel formation as an interstitial collagenase. Blood J Am Soc Hematol 119(21):5048–5056

    CAS  Google Scholar 

  22. Anuradha R, George JP, Pavankumar N, Kumaraswami V, Nutman TB, Babu S (2012) Altered circulating levels of matrix metalloproteinases and inhibitors associated with elevated type 2 cytokines in lymphatic filarial disease. PLoS Negl Trop Dis 6(6):e1681

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Sung C, Wang S, Hsu J, Yu R, Wong AK (2022) Current understanding of pathological mechanisms of lymphedema. Adv Wound Care 11(7):361–373

    Article  Google Scholar 

  24. Shevchenko AV, Prokofyev VF, Konenkov VI, Khapaev RS, Nimaev VV (2020) Polymorphism of vascular endothelial growth factor gene (VEGF) and matrix metalloproteinase (MMP) genes in primary limb lymphedema. Med Immunol (Russia) 22(3):497–506

    Article  Google Scholar 

Download references

Acknowledgements

All authors offer sincere appreciation to our patients for agreeing to donate their data to our study and have these published. We thank Dr. Mohammed Gohar (Microbiology department) and all the staff of Damietta university hospital Al-Azhar University for their technical support.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Author information

Authors and Affiliations

  1. Department of Medical Parasitology, Damietta Faculty of Medicine, Al-Azhar University, Damietta, Egypt

    Mohammed Youssef Shakra & Mostafa El Shahat

  2. Department of Clinical Pathology, Damietta Faculty of Medicine, Al-Azhar University, Damietta, Egypt

    Sherief Ibrahim & Amr Mohamed

  3. Department of Vascular Surgery, Faculty of Medicine, Al-Azhar University, Cairo, Egypt

    Alaa Sharapy

  4. Department of Medical Parasitology, Faculty of Medicine, Al-Azhar University, Cairo, Egypt

    Adel Omar

  5. Department of Clinical Pathology, Damietta Oncology Institute, Damietta,, Egypt

    Alshaimaa AlSaeed

Authors
  1. Mohammed Youssef Shakra
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Sherief Ibrahim
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mostafa El Shahat
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Amr Mohamed
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Alaa Sharapy
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Adel Omar
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Alshaimaa AlSaeed
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

MY conceived and designed the research. SI, ME, MY, AM, and AO conducted the experiments. SI, AM, MY, AS, and AA analyzed the data and wrote the manuscript. All authors made critical reviews and approved the final version.

Corresponding author

Correspondence to Mohammed Youssef Shakra.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the Research Ethical Committee of the Al-Azhar Faculty of Medicine. All patients signed informed consent before their inclusion in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Shakra, M.Y., Ibrahim, S., El Shahat, M. et al. Association between the single-nucleotide polymorphism (rs1030868) variant in matrix metallopeptidase 2 gene and the development of lymphedema. Egypt J Med Hum Genet 24, 27 (2023). https://doi.org/10.1186/s43042-023-00409-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43042-023-00409-x

Keywords