Association of MTHFR C677T polymorphism with risk of preterm birth in Indian mothers: a case–control study

Abstract

Background

Since MTHFR is the key enzyme in folate metabolism, its reduction can lead to hyperhomocysteinemia, which can have a negative impact on pregnancy outcome. Moreover, MTHFR polymorphism has also been linked with oxidative stress and genotoxicity. Identifying its ethnicity-specific association can help to reduce the incidence of preterm birth (PTB). Material and methods: Age-matched preterm birth mothers (< 37 weeks) and full-term mothers (> 37 weeks) were carefully selected for the study. The polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) method was adopted to analyse MTHFR C677T polymorphism. Oxidative stress (OS) analysis was performed by measuring the levels of antioxidants (superoxide dismutase (SOD) and catalase (CAT)) and OS damage markers (lipid peroxidation (LPO), total protein). Genotoxicity was confirmed by the cytokinesis-block micronucleus cytome (CBMN-Cyt) assay. The statistical analysis was performed by Student’s t test, chi-square test, and one-way ANOVA. The relevant risk of premature delivery was represented by odds ratios (ORs) with 95% confidence intervals (95% CIs).

Results

The MTHFR polymorphism showed statistical significance for PTB outcome with CT and TT genotype frequencies at p < 0.01 and p < 0.05, respectively, between cases and controls. Within the PTB categories (extreme-, very-, moderate-PTB), TT genotype showed statistical significance at (p < 0.05), while CT genotype remained insignificant. Also, statistically high oxidative stress and DNA damage were observed in cases compared to controls for all genotypes. Furthermore, the T allele of the MTHFR gene was found to be linked with significantly increased OS and DNA damage on comparison within the groups.

Conclusions

This study confirms the MTHFR C677T polymorphism, oxidative stress, and genotoxicity biomarkers are associated with the PTB outcome. Analysis of these biomarkers during pregnancy can be of clinical significance.

Background

Preterm birth (PTB) (birth before 37 weeks of gestation) is the leading cause of neonatal mortality and is linked to long-term disabilities in survivors. Since it is a multifactorial condition, it is influenced by a variety of factors including environmental, physiological, and epigenetic [1]. Growing evidence suggests that the genes linked with the folate metabolism pathway are involved in PTB outcome. Among numerous genetic variants, the single nucleotide polymorphisms (SNPs) of the methylenetetrahydrofolate reductase (MTHFR) gene are gaining importance due to their involvement in hyperhomocysteinemia, which can lead to an increased risk of adverse birth outcomes.

Pregnant women may be exposed to oxidative stress-inducing situations on a daily basis, such as toxins in drinking water and food, cigarette smoking or air pollution. Monitoring oxidative stress in pregnant women is critical for understanding the link between oxidative stress and pregnancy outcome, and some studies have found links between oxidative stress and poor prenatal outcomes such as PTB [2, 3]. Antioxidant enzymes such as superoxide dismutase (SOD) and catalase (CAT) and vitamins such as vitamins C, E and folate actively eliminate reactive oxygen species (ROS) by transforming the noxious forms of oxygen into innocuous molecules [4, 5].

The role of the folate metabolism, antioxidant system, and MTHFR C677T polymorphism (rs1801133) with the PTB outcome has been investigated on a wide range of ethnicities across the world [6,7,8,9]. Unfortunately, even with high numbers of PTB cases and related complications in India, there is just one previous study from the northern region of India on MTHFR C677T polymorphism [10]. Therefore, this study aimed to analyse the effect of MTHFR C677T variants on pregnancy outcome and whether it has any correlation with oxidative stress and DNA damage markers.

Methods

Study design

The current case–control study included a total of 200 individuals, who were further classified based on gestation age, with 100 full-term birth mothers (> 37 weeks) and 100 preterm birth mothers (<37 weeks). All mothers delivered babies with a cephalic presentation at the GMERS Medical College and Hospital in Gujarat, India. The study was approved by the Institutional Ethical Committee of Gujarat University (GUJIEC_03_2017) and GMERS Medical College and Hospital, Sola (GMERSMCS/IEC/37/2018). Gestation age was confirmed by LMP (last menstrual period) and sonography. Mothers with vaginal infection, multiple gestations, pregnancy with Mullerian anomalies, caesarean delivery, and non-cephalic presentation were excluded. Inclusion and exclusion criteria were decided to make sampling more uniform for both the groups and eliminate conditions that are primarily known to be linked with PTB or related complications. The blood collection with consent was taken from the participants at the time of enrolment.

MTHFR genotype distribution

First, the isolation of DNA was carried out from 2 ml of EDTA blood by the method of John et al. [11] with slight modification. Then, the MTHFR 677C-T polymorphism was detected after PCR amplification using the primers 5'TGAAGGAGAAGGTGTCTGCGGGA3' and 5'AGGACGGTGCGGTGAGAGTGY3' [12], followed by allele-specific restriction digestion using the Hinf I enzyme, and then restriction fragments were separated by 3% agarose gel electrophoresis and visualized under UV light. The MTHFR PCR amplification showed the presence of a 198 bp band, which after enzyme treatment generated fragments of the single uncut band of 198 bp (wild type-CC), two bands of 198 + 175 bp (heterozygote) or one band of 175 bp (homozygote mutant) characterized as heterozygous (CT), and homozygous mutant (TT) variants, respectively, which can be visualized through gel documentation system (Fig. 1).

Fig. 1

Gel picture showing MTHFR C/C, C/T, and T/T polymorphism, where L: 100 bp Ladder; CC genotype: 198 bp; CT genotype: 198 bp + 175 bp; TT genotype: 175 bp

Oxidative stress markers

The serum was separated at 2000 rpm for 15 min at 4 °C, and isolated serum was then collected in the microfuge tube, stored at − 20 °C, and processed within 12 h for all the assays.

Antioxidants, i.e. superoxide dismutase (SOD) and catalase (CAT), were measured using the method of Kakkar et al. [13] and Sinha [14], respectively. Furthermore, non-enzymatic markers, i.e. lipid peroxidation (LPO) and total protein, were analysed by the method of Ohkawa et al. [15] and Lowry et al. [16], respectively.

Cytokinesis-block micronucleus cytome assay markers (CBMN-Cyt assay) [17]

The cultures were set according to the standard protocol, and cytochalasin B (10 mg/mL) was added at 44 h of incubation. The cultures were harvested at the 72-h hypotonic treatment 0.075 M KCL (37 °C) for 20 min followed by fixative (1:3 acetic acid/methanol) treatment. The slides were prepared, stained with 2% Giemsa stain, and labelled with the code number and observations noted. The frequency of micronuclei (MN), nucleoplasmic bridges (NPB), or nuclear buds (NBUD) was determined by scoring 1000 BN cells from each duplicate culture.

Statistical analysis

MTHFR gene polymorphism was analysed by chi-square tests. The odds ratio and 95% CI were calculated to estimate the risk of different genotypes. The oxidative stress parameters and CBMN-Cyt assay were expressed as mean ± SEM. A comparison of oxidative stress and CBMN-Cyt assay markers with MTHFR genotypes for both the groups was made by unpaired Student’s t test. Moreover, a comparison within the groups (controls/cases) was made using one-way analysis of variance (ANOVA). The GraphPad Prism 7.0 software was used to verify values, and p < 0.05 was considered statistically significant.

Results

MTHFR genotype distribution

The polymorphism frequencies have shown statistical significance between preterm and full-term mothers (Table 1) with CT and TT genotype frequencies at p < 0.01 and p < 0.05, respectively. Moreover, T allele distribution was statistically higher in cases than in controls (p < 0.05). When we compared the intercategories (extremely, very, moderately PTB) relative to the wild homozygous genotype, TT genotype showed significance (p < 0.05), while CT genotype remained insignificant (Table 2).

Table 1 MTHFR genotype frequency distribution in cases and controls

Table 2 MTHFR genotype frequency distribution among PTB categories

MTHFR polymorphism and oxidative stress markers

For all the genotypes of the control, PTB, and PTB sub-categories, the levels of enzymatic (SOD, catalase) and non-enzymatic markers (LPO, total protein) were compared. The levels of SODs were significantly decreased in all the genotypes of PTB compared to control (CC vs. CC- < 0.0001; CT vs. CT-p < 0.0001; TT vs. TT-p < 0.001). Likewise, the levels of catalase were also significantly decreased in all the genotypes of PTB (CC vs. CC-p < 0.0001; CT vs. CT-p < 0.05; TT vs. TT-p < 0.001). The non-enzymatic markers of oxidative stress in all the genotypes between cases and controls showed significantly high levels of LPO (CC vs. CC-p < 0.001; CT vs. CT-p < 0.0001; TT vs. TT-p < 0.0001) and low levels of total protein (CC vs. CC-p < 0.0001; CT vs. CT-p < 0.0001; TT vs. TT-p < 0.0001) in all the PTB genotypes. Comparison of the genotypes (CC vs CT vs TT) within the control group showed high statistical significance for all the markers (p < 0.0001), likewise comparison within the PTB group (CC vs CT vs TT) that showed significance at p < 0.0001 for SOD and CAT, p < 0.01 for LPO, and remained non-significant for the total protein (Table 3).

Table 3 Correlation of oxidative stress markers with MTHFR polymorphism in cases and controls

MTHFR polymorphism and CBMN-Cyt assay markers

Comparison between control and PTB showed a significantly high frequency of MN in all the genotypes (CC vs. CC-p < 0.01, CT vs. CT-p < 0.0001, TT vs. TT-p < 0.0001). The frequency of NBUD for control CT vs PTB CT showed a significant difference at p < 0.05, while other genotypes were non-significant. The frequency of NPB remained non-significant for all the genotypes. Comparison of MN frequencies for all the genotypes within the groups (CC vs CT vs TT) also showed statistical significance (control p < 0.0001, PTB p < 0.01) (Table 4). Likewise, comparing NBUD frequencies of all genotypes within the groups showed a significance of p < 0.05 in the PTB group, whereas controls remained non-significant (p < 0.001) (Table 4).

Table 4 Correlation of CBMN-Cyt assay markers with MTHFR polymorphism in cases and controls

Discussion

Mothers’ folate metabolism plays a critical role in keeping a healthy pregnancy, and studies have shown mixed results regarding its association with PTB [6, 18,19,20]. The MTHFR is the key enzyme in the folate pathway metabolism and converts 5,10-methylenetetrahydrofolate into 5-methyltetrahydrofolate, the main form of circulatory folate, which converts methionine from homocysteine, thus providing a methyl group for many biological reactions, including DNA methylation [21]. Many genetic mutations in MTHFR can reduce enzyme activity by increasing homocysteine concentration, which is also influenced by genetic and physiological factors, lifestyle, and consumption of B vitamins such as folates, cobalamin, vitamin B6, and riboflavin [22, 23]. The most prevalent mutation in the homocysteine metabolism pathway is the MTHFR C677T polymorphism, located at the folate binding site, where cytosine (C) is replaced by thymine (T) at nucleotide 677 and in the MTHFR enzyme that converts alanine to valine [24]. This polymorphism causes the expression of a thermolabile enzyme, in less specific activity in heterozygous (CT) and abnormal homozygous (TT) carriers [25]. Previous reports have shown that MTHFR C677T and A1298C can be associated with an elevated risk of PTB [6, 7]. Recently, the C/T genotype has been significantly associated with PTB and low birth weight in mothers of Down syndrome children [20]. The MTHFR gene mutation increases the need for folic acid, and low folate levels during pregnancy adversely affect the normal foetal growth and increase the risk of adverse pregnancy outcome [6, 7, 20].

Our results are consistent with several findings, which suggest a correlation between the MTHFR C677T polymorphism and the increased risk of preterm delivery as we reported T allele significantly increased the risk for PTB in the cases. Furthermore, we observed the homozygous mutant TT genotype only among the cases. From several other studies, it is evident that TT genotype carriers have been linked to an elevated risk of PTB [8, 9] due to low metabolic folate level. A study among Asian carriers also observed a prominent risk of PTB with maternal TT genotype [26]. However, some reports did not find any clear association between the MTHFR C677T polymorphism and the chances of preterm delivery [27, 28]. The diverse genetic backgrounds, geographical and regional variations could be the reasons behind such unequivocal data [29, 30]. Women in our study belonged to the low socio-economic background and mostly lacked sufficient nutritional demand and lived a stressful life which is likely to have higher oxidative stress (OS) and DNA damage. There is a scarcity of literature linking MTHFR gene polymorphism to oxidative stress and genotoxicity, and no allele-specific stratification is available. Therefore, our study also emphasized the correlation of genotype-specific MTHFR polymorphism with OS and CBMN-Cyt assay.

The rise in homocysteine levels can also lead to oxidative stress, arteriolar constriction, endothelial damage, and placental thrombosis [31]. All of these conditions may be linked to impaired uteroplacental circulation and prothrombotic changes in the vessel wall, insufficient trophoblast invasion into the uterine vasculature, and placental hypoperfusion, which trigger poor pregnancy outcomes such as PTB and low birth weight (LBW) [32, 33]. All the genotypes of the cases showed statistically high oxidative stress compared to the controls, suggesting that PTB mothers had comparatively lower antioxidant capacity. Further, the high statistical significance for the SOD, CAT, and LPO within the cases establishes an association of the T allele with the higher OS. Similar observations within control group genotypes clearly indicate that the T allele is indeed associated with the elevated OS during pregnancy. The mechanisms underlying the link between folate deficiency/hyperhomocysteinemia and oxidative stress and its association with oxidation and auto-oxidation of homocysteine together with a reduction in antioxidant enzyme activities are not fully understood [34].

Recent studies have shown an association between micronucleus (MN) formation and folate levels. As folate is crucial in the DNA methylation process, DNA hypomethylation, a marker of folic acid deficiency, has been linked to chromosome loss, most likely due to pericentromeric heterochromatin under condensation [35]. Chromosome loss results in the formation of MN and aneuploidy, which is recognized as a potential risk indicator for PTB in our study. Studies have linked folate deficiency to genomic damage, the formation of MN, and other nuclear abnormalities in human lymphocytes [36, 37]. Low folate levels or high homocysteine levels due to C677T MTHFR polymorphism increased genotoxicity and risk for PTB several folds. Although our study confirms relatively high genotoxic damage through higher MN frequencies in PTB for all the genotypes, the comparison within the genotypes of the cases showed significantly increased genotoxicity due to the mutant T allele. Similar observations in control mothers suggest that the DNA damage increases when coupled with the T allele of the MTHFR gene. Another genomic instability marker, NPB, which is formed by mis-repair of DNA breaks or telomere end fusions showed no significant difference between both the groups also within the groups. Likewise, for the NBUD, which is predictive of gene amplification, significance was observed only in the CT variants of both groups but not in the other genotypes (CC, TT). However, comparisons within genotypes of cases revealed statistical significance for NBUD frequency, indicating that the genomic damage markers had an association with the T allele for the PTB risk. A study by Leopardi et al. [38] confirmed NBUD and NPB as novel biomarkers other than MN indicating low folate levels in women in their study. In addition to that, they observed higher NPB specifically in TT genotype of MTHFR. Our study shows that MTHFR polymorphism, oxidative stress, and DNA damage play a role in PTB outcome although the correlation between them could not be established definitely here.

Due to the polymorphism and low folate levels, pregnancy outcome gets affected majorly. Interestingly, it has been found that various dietary conditions can alter the functions of MTHFR genotypes [39]. Further, in our previous report, we observed a significantly high number of healthier full-term births in the group of mothers who maintained regularity in folic acid intake [40]. Thus, to reduce the risk of a poor obstetric outcome, pregnant women should be evaluated for their metabolic folate levels and advised folic acid dosages according to their condition to minimize the effects of MTHFR polymorphism for the better pregnancy outcomes. The finding of the present study is limited to a smaller population and a specific ethnicity; therefore, it needs to be validated in a larger cohort.

Conclusions

Better knowledge of the mechanisms behind PTB complications would help identify mothers who are at risk and deal with this crucial pathology more effectively. The present analysis confirms the role of maternal MTHFR C677T polymorphism with PTB risk. The mutant T allele of MTHFR gene, in particular, is thought to increase the risk of PTB by altering gene function and causing faulty folate metabolism.