Skip to main content
Egyptian Journal of Medical Human Genetics
Download PDF

Impact of Cytochromes P450 3A4 and 2B6 gene polymorphisms on predisposition and prognosis of acute myeloid leukemia: an Egyptian case-control study

Egyptian Journal of Medical Human Genetics volume 22, Article number: 38 (2021) Cite this article

Abstract

Background

It has been postulated that the interaction between environmental risk factors and genetic susceptibility is a possible cause for the development of acute myeloid leukemia (AML). Cytochrome P450 (CYP) detoxification enzymes are responsible for the elimination of oxidative stress. Genetic polymorphisms in these enzymes may cause AML due to enhanced accumulation of reactive oxygen species. To study the association between CYP3A4 (A290G) and CYP2B6 (G516T) gene polymorphisms and the predisposition and prognosis of AML, 50 upfront AML patients and 50 healthy individuals were genotyped for CYP2B6 (G516T) and CYP3A4 (A290G) single-nucleotide polymorphisms (SNPs) using polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP) technique. The polymorphisms were evaluated in relation to the response to chemotherapy and survival.

Results

CYP2B6 gene mutation carries a threefold risk of developing AML (odds ratio [OR], 3.0; 95% confidence interval [CI], 1.3–6.9), whereas CYP3A4 gene mutation carries approximately fourfold risk (OR, 3.8; 95% CI, 1.4–10.1). The presence of combined gene mutation conferred about 15-fold increased risk of developing AML compared with the presence of a single gene mutation (OR, 14.8; 95% CI, 1.8–124.2). CYP3A4 gene mutation is associated with worse overall survival (P = 0.030).

Conclusion

CYP enzyme gene polymorphisms are associated with the development of AML. Elimination of oxidative stress in genetically susceptible individuals may decrease the risk of AML and may improve survival.

Background

Acute myeloid leukemia (AML), which is characterized by the infiltration of the bone marrow (BM), blood, and other tissues by proliferative, clonal, abnormally differentiated and sometimes poorly differentiated cells of hematopoietic origin, is the most common type of acute leukemia in adults [1, 2]. The etiology of this disease is almost unknown; however, the interaction between environmental risk factors and genetic susceptibility has been postulated to be a possible cause for the development of AML [3]. Cytochrome P450 (CYP) detoxification enzymes play a crucial role in protecting cells against oxidative damage; CYP metabolizes many exogenous and endogenous genotoxic compounds through the insertion of an atom from molecular oxygen to the substrate, such as hydrogen peroxide [4].

CYP3A4 is the most abundantly expressed CYP in adult human liver; it constitutes approximately 15%–30% of the microsomal P450 pool and is responsible for the metabolism of about 30%–40% of all clinically used drugs [5, 6]. CYP2B6 is also a member of the CYP superfamily B that is mainly expressed in the liver [7].

Certain single-nucleotide polymorphisms (SNPs) at the CYP genetic loci (CYP2D6, CYP1A1, CYP3A5, and CYP2E1) may be considered as risk factors for many types of cancer and hematological malignancies, such as AML, acute lymphoblastic leukemia, and myelodysplastic syndromes, through the inactivation of enzymatic activity [8,9,10,11,12,13,14].

G516T SNP at the CYP2B6 gene locus has been identified as a nonsense polymorphism that reduces the activity of functional protein. Thus, individuals carrying the T allele (TT) have a lower enzymatic activity than individuals carrying the wild-type G allele (GG), whereas individuals carrying the genotype GT show intermediate activity [15].

CYP3A enzyme activity varies among ethnicities because of interindividual variability; CYP3A4 activity may vary by up to 50-fold. Most genetic polymorphisms to the CYP3A4 gene result in the decreased function of the enzyme activity. SNPs in the CYP3A4 promoter region (A290G) (i.e., CYP3A4*1B) have been implicated as a possible cause of this variability; subsequently, it may be considered as a risk factor for cancer, but the effects of this SNP remain not well defined [16,17,18,19].

This study aimed to evaluate the association between CYP2B6 (G515T) and CYP3A4 (A290G) SNP and AML susceptibility in Egyptian patients and their effect on the response to chemotherapy.

Methods

Clinical demography

This study included 50 newly diagnosed AML patients and 50 age- and sex-matched healthy individuals. The study was conducted in accordance with the Declaration of Helsinki and was approved by the Research Ethics Committee of our institute (reference number, I-251014). Informed consent was obtained from each participant.

Diagnosis was established between June 2015 and August 2017, based on the World Health Organization requirements [20] of 20% of BM or peripheral blood blasts, except for cases carrying the recurrent cytogenetic abnormalities t(15;17), t(8;21), inv.(16), or t(16;16). Cases were subjected to full history-taking, thorough clinical examination, routine laboratory investigations including complete blood count and Leishman-stained peripheral blood film examination, BM examination for French-American-British (FAB) classification [21], cytochemistry, immunophenotyping by flow cytometry, cytogenetic studies, and finally genotyping of CYP2B6 (G516T) and CYP3A4 (A290G) SNPs using polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP) technique.

Patients were initially treated with 3 + 7 regimen, combining daunorubicin 45 mg/m2 IV at days 1–3 and cytosine arabinoside (ara-C) 100 mg/m2 by continuous infusion from day 1 to day 7 for induction. The response was evaluated by the end of week 4. If the BM was not hypocellular and there was unequivocal residual leukemia, a second course of therapy with HAM regimen (high-dose ara-C [HiDAC] and mitoxantrone) was administered as follows: ara-C 3 g/m2 from day 1 to day 3 by infusion for 3 h and mitoxantrone 12 mg/m2 from day 3 to day 5 by short infusion. After achieving complete remission (CR), consolidation chemotherapy was performed by HiDAC (3 g/m2 for 3 h every 12 h at days 1, 3, and 5). Morphologic CR was defined according to the standard criteria by Cheson [22], namely, an absolute neutrophil count of ≥1.0 × 109/L, a platelet count of ≥100 × 109/L, < 5% blasts in BM, and no extramedullary leukemia. The minimum follow-up period was 6 months. Overall survival (OS) was calculated from the date of diagnosis to death from any cause or the date of the final follow-up. Disease-free survival (DFS) was defined as the time from achieving CR to relapse or death or the date of the final follow-up.

Molecular analysis

Sampling

For each patient, 3–5 mL of venous blood was collected on ethylenediaminetetraacetic acid by sterile venipuncture using a sterile Vacutainer tube. Samples were either stored in the same Vacutainer at − 20 °C or used directly within 24 h for DNA extraction.

DNA extraction

Genomic DNA was extracted from the whole blood by ready-made isolation kit (TIANamp Genomic DNA Kit catalog no. DP 318-02; TIANGEN Biotech, Beijing, China) according to the manufacturer’s instructions.

Genotyping

For genotyping of the CYP2B6 (G516T) SNP, the forward primer sequence was 5’GGTCTGCCCATCTATAAAC3`, and the reverse was 5’CTGATTCTTCACATGTCTGCG3`. As for the CYP3A4 (A290G) SNP, the forward primer sequence was 5`- GGA CAG CCA TAG AGA CAAGGG CC- 3`, and the reverse primer sequence was 5` - TCACTGACCTCCTTT GAG TTC ATA- 3`.

For CYP2B6 (G516T) SNP, the thermal cycling conditions were initial denaturation for 5 min at 95 °C, 30 cycles of 30 s at 95 °C, 30 s at 50 °C, and 1 min at 72 °C with a final step of 10 min at 72 °C. For CYP3A4 (A290G) SNP, the cycling conditions were initial denaturation for 10 min at 95 °C, 35 cycles of 45 s at 95 °C, 45 s at 59 °C, and 1 min at 72 °C. The last elongation step was extended to 7 min. The resulting PCR products were digested with BsrI (New England Biolabs Organic, Beverly, MA, USA) and Msp1 restriction enzyme (New England Biolabs, Ipswich, MA, USA) for the CYP2B6 (G516T) and the CYP3A4 (A290G) SNPs, respectively, according to the manufacturer’s instructions. Digested fragments were separated on 2% agarose gel, and RFLP bands were visualized by ethidium bromide staining under ultraviolet light. The CYP2B6 (G516T) SNP digestion products were three fragments of 241, 268, and 17 bp when the wild-type G allele was present and a single fragment of 509 bp when the T mutant allele was present (Fig. 1). As for the CYP3A4 (A290G) SNP, two fragments of 142 and 23 bp were produced when the mutant G allele was present and a single band of 165 bp when the wild A allele was present (Fig. 2).

Fig. 1
figure 1

PCR/RFLP detection of CYP2B6-G-516 T Polymorphism. Lane 1: 50 bp ladder. Lanes 2, 4, 6 and 8: Wild type (GG) showing two bands at 268 and 241 bp. Lanes, 3 and 5: Heterozygous mutant (GT) showing three bands at 509, 268 and 241 bps

Full size image
Fig. 2
figure 2

PCR/RFLP detection of CYP3A4-A-290G Polymorphism. Lane 1: 50 bp ladder. Lanes 2, 4 and 5: Wild type (AA) showing one band at 165 bp. Lanes, 7 and 8: Heterozygous mutant (AG) showing two bands at 165 and 142 bps. Lane 3: Homozygous mutant (GG) showing one band at 142 bp

Full size image

Statistical methods

Data were coded and entered using the SPSS statistics version 23 and were summarized using mean and standard deviation for quantitative variables and frequencies (number of cases) and relative frequencies (percentages) for categorical variables. Unpaired t-test was used to compare between quantitative variables and chi-square (χ2) test to compare categorical data. When the expected frequency is < 5, exact test was used instead. Genotype and allele frequencies were compared between the disease and control groups using chi-square tests. Odds ratio (OR) with 95% confidence intervals (CIs) was calculated. P < 0.05 was considered statistically significant.

Results

The study involved 50 newly diagnosed AML patients (AML group) and 50 age- and gender-matched healthy individuals (control group). The median age of patients was 35.9 years (range, 17–64 years); 32 (64%) were male, and 18 (36%) were female.

Upon examination of the AML group, 27 patients (54%) had splenomegaly and 22 (44%) had hepatomegaly. At diagnosis, the mean hemoglobin level among the studied patients was 7.9 ± 1.9 g/dL, the platelet count ranged from 21.4 to 110.5 × 103/μL and the total leukocyte count ranged from 9.2 to 95.7 × 109/L.

According to FAB classification, 19 patients (38%) were classified as FAB M2, 10 (20%) were FAB M1, 6 (12%) were FAB M5, 6 (12%) were FAB M4, 5 (10%) were FAB M3, 3 (6%) were FAB M0, and 1 (2%) was FAB M6.

Cytogenetic analysis of the 50 AML patients revealed abnormal cytogenetics in 32 patients (64%). The frequencies of different cytogenetic abnormalities detected in the AML group are presented in Table 1. The most frequent cytogenetic group was cytogenetically normal (normal cytogenetic [NCG]), which was detected in 18 patients followed by t(15:17). Furthermore, AML patients were stratified into three risk groups according to cytogenetic structure [23]: 14 patients (28%) belonged to favorable-risk group, 29 (58%) belonged to intermediate-risk group, and 7 (14%) had poor prognosis.

Table 1 Frequency of cytogenetic characteristics in AML group
Full size table

The entire AML group received chemotherapy regimens. Notably, 45 patients (90%) received 3 + 7 regimen; 5 patients (10%) received all-trans retinoic acid, whereas 3 patients (6%) received fludarabine+HiDAC+G-CSF therapy. The initial response to therapy was assessed at day 28. CR was attained in 30 patients (60%), whereas 6 patients died before reaching remission.

Regarding the distribution of CYP2B6 (G516T) gene polymorphism in patients and control group, the wild-genotype GG was encountered in 23 AML patients (46%) and 36 of the control group (72.0%), the heterozygous mutant genotype GT was encountered in 19 of AML patients (38%) and 12 of the control group (24%), and the homozygous mutant genotype TT was encountered in 8 of AML patients (16%) and 2 of the control group (4%). The mutant genotype frequency distribution was significantly higher in the AML group than control subjects (P = 0.017) (Table 2). The presence of CYP2B6 gene mutation (homo- or heterozygous) carries a threefold risk of developing AML (OR, 3.0; 95% CI, 1.3–6.9) (Table 3).

Table 2 CYP2B6 gene polymorphism distribution in the two studied groups
Full size table
Table 3 Risk estimate for AML in the two studied genes
Full size table

CYP3A4 (A290G) gene polymorphism distribution shows that the wild genotype (AA) was encountered in 31 AML patients (62%) and 43 of the control group (86%), the heterozygous mutant genotype AG was encountered in 16 of AML patients (32%) and 7 of the control group (14%), and the homozygous mutant genotype GG was encountered in 3 of AML patients (6%) and none of the control group. The frequency distribution of the mutant genotypes was significantly higher in the patients than controls (P = 0.006) (Table 2). The presence of CYP3A4 gene mutation (homo- or heterozygous) carried an approximately fourfold risk of developing AML (OR, 3.8; 95% CI, 1.4–10.1) (Table 3).

The distribution of the combined CYP2B6 and CYP3A4 gene mutations among patients and controls revealed only 1 case of combined gene mutation in the control group compared with 14 cases in the AML group (P = 0.003). The presence of combined gene mutation conferred about a 15-fold increased risk of developing AML compared with the presence of a single gene mutation (OR, 14.8; 95% CI, 1.8–124.2) (Table 3).

The gene polymorphism of both CYP2B6 and CYP3A4 did not show any association with demographic, clinical, or laboratory characteristics of the AML patients (Table 4).

Table 4 Relation of CYP2B6 gene polymorphism and CYP3A4 gene polymorphism with demographic, clinical and laboratory data in AML patients
Full size table

Cytogenetic risk stratification showed a significant association between CYP3A4 gene mutation and unfavorable cytogenetic risk (P = 0.031). The presence of CYP3A4 mutation was found to be a risk factor for unfavorable cytogenetic profile in AML patients (OR, 2.8; 95% CI, 0.8–10.2). However, there was no significant association between CYP2B6 gene mutation and cytogenetic risk stratification (Table 5).

Table 5 Relation between cytogenetic risk stratification and CYP gene mutations
Full size table

Overall survival

The cumulative OS proportion of AML patients was 48.5% at 9 months. The median survival time was 9 months (95% CI, 7.8–10.2 months). CYP3A4 mutation was associated with worse OS (P = 0.030) (Fig. 3). In contrast, OS was not affected by the presence of CYP2B6 gene mutations (P = 0.827) (Table 6).

Fig. 3
figure 3

Overall survival curves of AML patients with and without mutations of CYP3A4 gene

Full size image
Table 6 Overall survival of AML patients in relation to gene polymorphism of CYP2B6 and CYP3A4
Full size table

Those with combined CYP2B6 and CYP3A4 gene mutations had worse OS than AML patients with a single gene mutation: the median survival time was 12.0 months (95% CI, 8.7–15.3) in cases with wild CYP3A4 genotype, whereas 9.0 months (95% CI, 7.8–10.2) in the mutant genotype (P = 0.030) (Fig. 4).

Fig. 4
figure 4

Overall survival curves of AML patients with single and combined mutations of CYP2B6 and CYP3A4 genes

Full size image

Disease-free survival

At 9 months, the cumulative DFS proportion of the 30 AML patients who achieved CR was 44.6%. The median DFS was 9 months (95% CI, 5.8–12.2 months). DFS was not affected by the presence of CYP2B6 gene mutations (P = 0.352) or CYP3A4 mutation (P = 0.195). In addition, no significant difference was found in DFS among patients with a single gene mutation of one of the CYP2B6 and CYP3A4 genes compared with those with combined mutations (P = 0.265) (Table 7).

Table 7 Disease-free survival of AML patients in relation to gene polymorphism of CYP2B6 and CYP3A4
Full size table

Discussion

AML is a form of cancer characterized by the infiltration of malignant cells to the blood, BM, and other tissues. Fifty years ago, AML was incurable; however, a few years ago, the prognosis improved and now AML is curable in 35%–40% of adult patients aged ≤60 years [23].

The exact causes of leukemia are still unknown despite widespread studies that investigated the mechanisms of the disease. It is believed that the exposure of DNA to reactive oxygen species in the hematopoietic stem cells is an important factor in the development of leukemia [24]. CYP enzymes play an important role in the elimination of oxidative stress.

Genetic polymorphisms in these enzyme systems are associated with the reduction of CYP enzymes; thus, it can influence cancer susceptibility [8, 9].

The current work studied the possible association between CYP2B6 (G516T) and CYP3A4 (A290G) gene polymorphisms and susceptibility to AML in the Egyptian population and the association between CYP genotypes and the clinical presentation, hematological and cytogenetic findings, and treatment response in AML cases to justify whether such polymorphisms have any effect on the disease prognosis.

In this study, the mutant CYP2B6 genotypes were significantly higher in patients than controls (P = 0.017). Calculated risk estimation revealed that the mutant genotypes conferred a threefold increased risk of developing AML (OR, 3.3; 95% CI, 1.3–6.9).

In 2009, Bekroz et al. investigated the association between CYP2B6 gene polymorphism and the susceptibility to acute leukemia in the Turkish population. Their study included 80 acute leukemia patients (44 of the patients had acute lymphocytic leukemia [ALL] and 36 had AML) and 100 control subjects [25]. Logistic regression analyses revealed a significant correlation between the CYP2B6 (G516T) polymorphism and patients with acute leukemia (OR, 2.481; 95% CI, 1.353–4.551; P = 0.003). In addition, in agreement with our results, Yuan et al. (2011) reported that the GT and GT + TT genotype frequencies of c.516G > T SNP were higher in ALL (37.5% and 42.7%, respectively; P < 0.01) and AML (37.2% and 40.9%, respectively; P < 0.01) than control subjects [13].

Regarding the CYP3A4 (A290G) SNP, the mutant genotypes were overrepresented in patients compared with the control subject (P = 0.006). The presence of the mutation, whether homozygous or heterozygous, carried an approximately fourfold increased risk of developing AML (OR, 3.8; 95% CI, 1.4–10.1).

In agreement with our data, Ali et al., in a case-control study involving 77 newly diagnosed AML cases and 72 age- and sex-matched healthy controls, reported a high frequency of the homozygous genotype (GG) in AML cases, although not statistically significant (P = 0.999). The G allele was significantly frequent in AML cases (P = 0.001; OR, 17.9; 95% CI, 4.041–78.903) [26].

Similar to our results, Voso et al., in a case-control study involving 160 cases of AML and 162 matched controls, reported a significantly higher prevalence of the polymorphic variant CYP3A4 (A290G) genes in AML cases than controls (9.4% vs 3.1%; P = 0.04), increasing the risk of developing AML to 3.2-fold (95% CI, 1.1–11.5) [14].

In contrast, Pakakasama et al. analyzed 107 children with ALL and 320 healthy controls for CYP3A4 (A290G) polymorphism and reported an insignificant difference in the distribution of the polymorphism between patients and controls [25]. This difference may be explained by the variability of the risk factor for acute leukemia between children and adults.

Naoe et al. studied the CYP3A4 (A290G) polymorphism in 58 patients with t-AML/t-MDS and 150 Japanese healthy individuals and found that all subjects had the wild genotype, except 1 case that had a heterogeneous genotype, indicating a very low frequency or a lack of CYP3A4 (A290G) polymorphism in the Japanese population [27]. This may be explained by ethnic variability.

The distribution of combined CYP2B6 and CYP3A4 gene mutations was also significantly increased in patients compared with controls (P = 0.003). The presence of combined gene mutation carried an approximately 15-fold increased risk of developing AML compared with the presence of a single gene mutation. To the best of our knowledge, no published study investigated the risk of this combined gene polymorphism and AML.

Similar to these results are those reported by Alazhary NM et al. (2015), who found no significant association between CYP2B6 polymorphism and CR, cytogenetic analysis, and OS [28]. A cytogenetic analysis of 50 AML patients revealed abnormal cytogenetics in 32 patients (64%) and NCG in 18 patients (36%). Risk stratification according to the cytogenetic makeup of AML patients revealed 14 favorable (28%) and 36 nonfavorable patients (72%). In this study, no significant association was found between the presence of mutation in the CYP2B6 gene and cytogenetic risk stratification of AML patients. In contrast, a significant association was found between CYP3A4 gene mutation and unfavorable cytogenetic risk.

In another study, Sophia et al. (2014) reported a higher frequency of the mutant CYP2B6 (G516T) allele in patients with poor prognosis based on cytogenetic findings, indicating that the presence of the variant allele is probably related to specific chromosomal abnormalities conferring a poor prognosis [29].

Furthermore, we found that CYP3A4 (A290G) mutation was significantly associated with worse OS (P = 0.030). In contrast, OS was not affected by the presence of CYP2B6 gene mutations (P = 0.827). Patients carrying mutation of both genes had worse OS (P = 0.030) than patients with a single gene mutation.

DFS was not affected by the presence of CYP2B6 gene mutations (P = 0.352) or CYP3A4 gene mutation (P = 0.195). In addition, there was no significant difference in DFS between patients with a single gene mutation of one of the CYP2B6 and CYP3A4 genes compared with those with combined mutations (P = 0.265).

Similarly, Ali et al. (2013) reported that there was no significant association between CYP3A4 (A290G) SNP and different clinical or laboratory parameters and the early response to treatment, OS, and the DFS [26].

Conclusion

The results of this study provide an evidence for the possible pathogenetic role of the CYP2B6 and CYP3A4 polymorphisms on the risk of developing AML. Moreover, having combined mutation in both genes increases such risk. CYP3A4 polymorphism was associated with an unfavorable cytogenetic risk and worse OS, suggesting that CYP3A4 may have a role in disease progression, therapeutic outcome, DFS, and OS in AML patients, whereas CYP2B6 mutations were not associated with such findings. Oxidative stress is an important risk factor for the development of AML. The elimination of oxidative stress in genetically susceptible individuals may decrease the risk of AML and may improve survival.

Further studies are needed to be conducted on a larger sample size and on other populations to verify the prognostic implications of the CYP2B6 and CYP3A4 polymorphisms on treatment outcome and disease progression.

Availability of data and materials

Availability of data and materials: they are available from Nasser research institute for research and treatment but restrictions apply to the availability of these data and so are not publicly available. Data are however available from the corresponding author upon reasonable request.

Abbreviations

Cyp:

Cytochrome p 450

RFLP:

Restriction fragment length polymorphism

SNP:

Single nucleotide polymorphism

PCR:

Polymerase chain reaction

FAB:

French-American-British

DFS:

Disease free survival

References

  1. Deschler B, Lubbert M et al (2006) Acute myeloid leukemia: epidemiology and etiology. Cancer 107:2099–2107.

    Article  Google Scholar 

  2. Lowenberg B, Downing JR, Burnett A (1999) Acute myeloid leukemia. N Engl J Med 341:1051–1062.

    Article  CAS  Google Scholar 

  3. Estey E, Dohner H (2006) Acute myeloid leukemia. Lancet. 368:1894–1907

    Article  Google Scholar 

  4. Roy P, Yu LJ, Crespi CL, Waxman DJ (1999) Development of a substrateactivity based approach to identify the major human liver P-450 catalysts of cyclophosphamide and ifosfamide activation based on cDNA-expressed activities and liver microsomal P-450 profiles. Drug Metab Dispos. 27:655–666.

    Google Scholar 

  5. Antona RC, Ingelman-Sundberg M (2006) Cytochrome P450 pharmacogenetics and cancer. Oncogene 25:1679–1691.

    Article  Google Scholar 

  6. Zanger UM, Turpeinen M, Klein K, Schwab M (2008) Functional pharmacogenetics/genomics of human cytochromes P450 involved in drug biotransformation. Anal Bioanal Chem 392(6):1093–1108.

    Article  CAS  Google Scholar 

  7. Hoffman SM, Fernandez-Salguero P, Gonzalez FJ et al (1995) Organization and evolution of the cytochrome P450 CYP2A-2B-2F subfamily gene cluster on human chromosome 19. J Mol Evol 41:894–900.

    CAS  PubMed  Google Scholar 

  8. Dong LM, Potter JD, White E et al (2008) Genetic susceptibility to cancer: the role of polymorphisms in candidate genes. JAMA. 299:2423–2436.

    Article  CAS  Google Scholar 

  9. Agundez JA (2004) Cytochrome P450 gene polymorphism and cancer. Curr Drug Metab 5:211–224.

    Article  CAS  Google Scholar 

  10. Bozina N, Bradamante V, Lovrić M (2009) Genetic polymorphism of metabolic enzymes P450 (CYP) as a susceptibility factor for drug response, toxicity, and cancer risk. Arh Hig Rada Toksikol 60:217–242.

    Article  CAS  Google Scholar 

  11. Majumdar S, Mondal BC, Ghosh M, Dey S, Mukhopadhyay A et al (2008) Association of cytochrome P450, glutathioneS-transferase and N-acetyltransferase 2 gene polymorphisms with incidence of acute myeloid leukemia. Eur J Cancer Prev 17:125–132.

    Article  CAS  Google Scholar 

  12. Berköz M, Yalin S (2009) Association of CYP2B6 G15631T polymorphism with acute leukemia susceptibility. Leuk Res 33:919–923.

    Article  Google Scholar 

  13. Yuan ZH, Liu Q, Zhang Y et al (2011) CYP2B6 gene single nucleotide polymorphisms and leukemia susceptibility. Ann Hematol 90:293–299.

    Article  CAS  Google Scholar 

  14. Voso MT, Fabiani E, D’Alo’ F et al (2007) Increased risk of acute myeloid leukaemia due to polymorphisms in detoxification and DNA repair enzymes. Ann Oncol 18:1523–1528.

    Article  CAS  Google Scholar 

  15. Hofmann MH, Blievernicht JK, Klein K et al (2008) Aberrant splicing caused by single nucleotide polymorphism c.516G.T [Q172H], a marker of CYP2B6*6, is responsible for decreased expression and activity of CYP2B6 in liver. J Pharmacol Exp Ther 325:284–292.

    Article  CAS  Google Scholar 

  16. Felix CA, Walker AH, Lange BJ et al (1998) Association of CYP3A4 genotype with treatment-related leukemia. Proc Natl Acad Sci U S A 95(22):13176–13181.

    Article  CAS  Google Scholar 

  17. Rebbeck TR, Jaffe JM, Walker AH et al (1998) Modification of clinical presentation of prostate tumors by a novel genetic variant in CYP3A4. J Natl Cancer Inst 90(16):1225–1229 Erratum in: J Natl Cancer Inst 1999 Jun 16;91 (12):1082. PMID: 9719084.

    Article  CAS  Google Scholar 

  18. Ball SE, Scatina J, Kao J, Ferron GM, Fruncillo R, Mayer P, Weinryb I, Guida M, Hopkins PJ, Warner N, Hall J (1999) Population distribution and effects on drug metabolism of a genetic variant in the 5′ promoter region of CYP3A4. Clin Pharmacol Ther 66(3):288–294.

    Article  CAS  Google Scholar 

  19. Paris PL, Kupelian PA, Hall JM et al (1999) Association between a CYP3A4 genetic variant and clinical presentation in African-American prostate cancer patients. Cancer Epidemiol Biomark Prev 8(10):901–905.

    CAS  Google Scholar 

  20. Wandt H, Haferlach T, Thiede C et al (2010) WHO classification of myeloid neoplasms and leukemia. Blood 115(3):748–749; author reply 749-50. https://doi.org/10.1182/blood-2009-10-249664.

    Article  CAS  PubMed  Google Scholar 

  21. Neame PB, Soamboonsrup P, Browman GP et al (1986) Classifying acute leukemia by immunophenotyping: a combined FAB immunologic classification of AML. Blood. 68(6):1355–1362.

    Article  CAS  Google Scholar 

  22. Cheson BD, Bennett JM, Kopecky KJ, International Working Group for Diagnosis, Standardization of Response Criteria, Treatment Outcomes, and Reporting Standards for Therapeutic Trials in Acute Myeloid Leukemia et al (2003) Revised recommendations of the international working Group for Diagnosis, standardization of response criteria, treatment outcomes, and reporting standards for therapeutic trials in acute myeloid leukemia. J Clin Oncol 21(24):4642–4649.

    Article  Google Scholar 

  23. Döhner H, Weisdorf DJ, Bloomfield CD (2015) Acute Myeloid Leukemia. N Engl J Med 373(12):1136–1152. https://doi.org/10.1056/NEJMra1406184.

    Article  CAS  PubMed  Google Scholar 

  24. Mandegary A, Rostami S, Alimoghaddam K et al (2011) Gluthatione-S-transferase T1-null genotype predisposes adults to acute promyelocytic leukemia; a case-control study. Asian Pac J Cancer Prev 12(5):1279–1282.

    PubMed  Google Scholar 

  25. Pakakasama S, Mukda E, Sasanakul W et al (2005) Polymorphisms of drug-metabolizing enzymes and risk of childhood acute lymphoblastic leukemia. Am J Hematol 79:202–205.

    Article  CAS  Google Scholar 

  26. Ali GT, Al-azhary NM, Mokhtar DA (2014) Frequency and prognostic significant of CYP3A4-a-290G polymorphism in acute myeloid leukemia. J Adv Res 5(6):657–661

    Article  Google Scholar 

  27. Naoe T (2000) Analysis of genetic polymorphism in NQO1, GST-M1, GST-T1, and CYP3A4 in 469 Japanese patients with therapy-related leukemia/Myelodysplastic syndrome and de novo acute myeloid leukemia. Clin Cancer Res 6:4091–4095

    CAS  PubMed  Google Scholar 

  28. Alazhary NM, Shafik RE, Shafik HE et al (2015) Prognostic value of a CYP2B6 gene polymorphism in patients with acute myeloid leukemia. Asian Pac J Cancer Prev 16(11):4583

    Article  Google Scholar 

  29. Daraki A, Zachaki S, Koromila T et al (2014) The G516T CYP2B6 Germline polymorphism affects the risk of acute myeloid leukemia and is associated with specific chromosomal abnormalities. PLoS One 9(2):e88879. https://doi.org/10.1371/journal.pone.0088879 Cai T, ed

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Special thanks are dedicated to clinical pathology department, Faculty of medicine, Cairo university professors, workers and for our Egyptian patients without whom this work would have not been completed.

Funding

This study was funded by the authors only.

Author information

Authors and Affiliations

  1. Clinical Pathology, Kasr Al Ainy Medical School, 26 Atbara st., Agouza, Giza, 12411, Egypt

    Shahira Kamal Anis Botros, Nesrine El Gharbawi & Gehan Shahin

  2. Internal Medicine, Kasr Al Ainy medical School, Giza, Egypt

    Hend Al Lithy

  3. Nasser Institute for Research and Treatment, Cairo, Egypt

    Mahmoud El Sherbiny

Authors
  1. Shahira Kamal Anis Botros
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Nesrine El Gharbawi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Gehan Shahin
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Hend Al Lithy
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Mahmoud El Sherbiny
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

NG: Study design. SB: Revision of the manuscript. GS: interpretation of data. HL: Data analysis. MS: Study design, drafting the work. All authors have read and approved the manuscript. All authors agreed both to be personally accountable for the author’s own contributions and to ensure that questions related to the accuracy or integrity of any part of the work, even ones in which the author was not personally involved, are appropriately investigated, resolved, and the resolution documented in the literature.

Corresponding author

Correspondence to Shahira Kamal Anis Botros.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the Research Ethics Committee (REC) of Cairo University Hospitals. (reference number, I-251014) A written informed consent was obtained from each participant.

Consent for publication

Not applicable.

Competing interests

The authors have no conflicts of interest to disclose.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Botros, S.K.A., El Gharbawi, N., Shahin, G. et al. Impact of Cytochromes P450 3A4 and 2B6 gene polymorphisms on predisposition and prognosis of acute myeloid leukemia: an Egyptian case-control study. Egypt J Med Hum Genet 22, 38 (2021). https://doi.org/10.1186/s43042-021-00145-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43042-021-00145-0

Keywords